Blog

AutoDock4 kullanılarak Moleküler Docking Çalışması

Molecular Docking, Newton dinamiklerini, termodinamiksel ve kimyasal hesaplamaları kullanarak iki molekülün (Reseptör-Ligand) kimyasal ve fiziksel özelliklerine bağlı olarak oluşturabileceği en stabil bulabilmek için, yapısal biyoloji alanında çok sık kullanılan bir yöntemdir. Moleküler Kenetlenme, hücre içinde bulunan komplekslerin (protein-protein, protein-ligand protein-antibody) anlık bir görüntüsünü bilgisayar ortamında oluşturup inceleyebilmemize olanak sağlar. Bu çalışmalar ise ilaç geliştirme çalışmalarından bir proteinin mekanizmasının anlaşılabilmesine, yeni bir ilaç adayı molekülün bulunmasına kadar birçok alanda bize bilgi sağlamaktadır. Ligand kimyası (iyonizasyon ve yapısal farklılıklar), Reseptörün esnekliği, proteinin kompleks oluştururken içinde bulunabileceği farklı konformasyonlar ve docking programlarının hesaplamada kullandığı farklı skorlama yöntemlerinin yeterliliği ise molecular docking çalışmalarında karşılaşılan güncel sorunlardır, gün geçtikçe bu problemleri çözmek için yeni algoritmalar ve farklı metotlar geliştirilmekte ve molecular docking çalışmaları her geçen gün daha güvenilir sonuçlar vermektedir (Guedes et al., 2018).

Şimdi bir docking çalışması ile metodumuzu daha iyi anlamaya çalışalım!

AutoDock4.2 ile Docking Çalışması

Aşağıda yapacağım uygulamalı anlatımda genel olarak docking işleminin nasıl gerçekleştiği fazla detaya girmeden genel hatları ile anlatmaya çalışacağım. Detaylı bilgileri merak edecek olanlar için aralıklarla linkler bırakacağım, bu linklerden makalelere gidip detaylı okumalar yapabilirsiniz.

Öncelikle biraz kullanacağımız programdan bahsedelim. AutoDock4 yaygın olarak kullanılan, Linux ve Windows gibi OS’larda çalışabilen ücretsiz bir şekilde indirip kullanabileceğiniz bir docking programıdır. AutoDock4 deneysel (experimental) ve bilgi temelli (knowladge-based) hibrit bir skor fonksiyonu kullanmaktadır. Bu hibrit fonksiyon sayesinde Autodock4, ligandların in-vitro bağlanlanma enerjilerine yakın değerler veremektedir.

AutoDock4.2 Skor Fonksiyonu (Hill & Reilly, 2015);

ΔGbinding = ΔGvdW + ΔGelec + ΔGhbond + ΔGdesolv + ΔGtors

ΔGvdW = 12-6 Lennard-Jones potential (with 0.5 Å smoothing)

ΔGelec = with Solmajer & Mehler distance-dependent dielectric

ΔGhbond = 12-10 H-bonding Potential with Goodford Directionality

ΔGdesolv = Charge-dependent variant of Stouten Pairwise Atomic Solvation Parameters

ΔGtors = Number of rotatable bonds

Program yukarıdaki metotlardan gelen deneysel ve teorik değerleri kullanarak protein ve ligandın atomlarının aralarında yaptığı etkileşimlere enerji olarak değerler verip, kompleks hakkında anlamlı sonuçlar çıkartmamıza yardımcı oluyor. 

Şimdi az çok programın nasıl çalıştığı anladıysak uygulamalı bir örneğe geçelim.

Histon Deasetilaz 6 (HDAC6) – Quisinostat

Quisinostat hala deneysel aşamada olan bir HDAC6 inhibitörüdür. Bu çalışmada daha önce ΔG binding ve Ki değeri deneysel olarak hesaplanmış ve Ki = 16.9nM olarak bulunmuştur (Carrillo et al., 2015). Bizde Autodock4 kullanarak bu değere yakın bir sonuç bularak deneysel olarak bulunan değere yakın bir değer bulmaya çalışacağız.

Protein ve Ligandın hazırlanması.

HDAC6 proteinini PDB:5EDU kodu ile Protein Data Bank (PDB)’dan, Quisinostat molekülünü ise pubchem adlı siteden sdf olarak indirebilirsiniz.

Protein ve Ligandın hazırlanması için çeşitli programlar kullanılabilir, bu çalışmada Laboratuvarımızda kullandığımız Biovia Discovery Studio 2016 programını kullanacağız. Bu program çeşitli protokoller için lisans gerektiren bir programdır ama aynı işlemleri Chimera veya PyMol ile de yapabilirsiniz.

Protein ve ligand hazırlamak için neler yapılmalıdır?

PDB’den indireceğimiz yapılar genellikle X-ray kristolografi yapıları oluyor ve bu yapılardan 3D yapı oluşturulurken loop veya proteinin diğer bölgelerinden eksik kısımlar, kristalleştirme sırasında kullanılan proteine ait olmayan moleküller gibi docking işlemi esnasında istemeyeceğimiz, sonucumuzu olumsuz etkileyecek yapıları tamamlamak veya temizlemek için proteini hazırlamamız gerekiyor. Bu işlem sırasında;

  1. Proteinin yapısına dahil olmayan moleküller siliniyor
  2. Side-Chain grupları optimize ediliyor
  3. Su molekülleri siliniyor
  4. Eksik loop ve diğer bölgeler tamamlanıyor.
  5. Proteinin fizyolojik koşullarda bulunduğu pH değerine göre side chainler protone ediliyor.

Ligand molekülünü hazırlamak için liganda göre farklı değişikliklerde yapılabileceği gibi, genel olarak protein ile aynı pH değerinde molekülü protone etmek yeterli olacaktır. Eğer bu işlemleri yapacak programa ve imkanlara herhangi bir sebepten erişme imkânınız yok ise buradaki linkten benim hazırladığım ve dockingde kullandığım hazırlanmış protein ve molekülü de indirebilirsiniz.

Bu iki molekülü hazırladıktan sonra bu moleküllerin AutoDock4 programında tanınması için PDB veya diğer desteklenen formatlardan kaydetmemiz gerekiyor.

Proteini ve ligandımızı hazırladığımıza göre şimdi ligand molekülümüzü nereye dock ediceğimizi tespit etmemiz gerekiyor. Bunun için daha önce yayınlanmış makalelerden araştırma yapabilirsiniz ya da kristal yapı oluşturulurken kullanınan (5EDU için) proteinin aktif bölgesinde bulunan TRICHOSTATIN A molekülünün ağırlık merkezini veya aktif side kısmında bulunan ve mekanizma için çok önemli olan Zn+2 atomuna yakın bir bölge seçebilirsiniz.

AutoDock4 ve Docking İşlemleri

AutoDock4 programının docking işlemleri için bazı parametre dosyalarına ihtiyacı vardır. Bu dosyaları oluşturmak için yine AutoDock programını geliştiren grup tarafından geliştirilen ADT (Autodock Tools) programını indirmemiz gerekiyor. Bu programı AutoDock4 (docking için) ve Autogrid4 (grip parametrelerini) hazırlamak için kullanacağız. Programları buradan indirebilirsiniz ve kurulumları için talimatları yine aynı siteden bulabilirsiniz.

Şimdi sırası ile Autodock Tools kullanarak gerekli dosyaları hazırlayalım.

1) Protein ve Ligandın Yüklenmesi

Figür 1. Ligandın yüklenmesi.

Programı açıp “Ligand –> Input -> Open ->” kısmında ligandımızı pdb olarak seçelim. Bu seçimi onayladıktan sonra program ligand hakkında ekrana bazı bilgiler vericek. Ardından ligandımızı yine aynı sekmedeki output seçeneği ile pdbqt olarak kaydedelim.

Proteinimizi programa yüklemek için “Grid -> Macromolecule -> Open ->” kısmından aynı şekilde proteinimizi pdb formatinda seçelim ve yine output seçeneğini kullanarak pdbqt olarak yazdıralım. Burada HDAC6 açısından dikkat etmemiz gereken bir durum oluştu, program aynı şekilde kaydettikten sonra ekrana bazı uyarılar veriyor ve bağlanma bölesinde kofaktör olan Zinc (çinko) atomunu değersiz olarak kaydediyor fakat HDAC6 içerisinde bu atomun +2 değerlik aldığını biliyoruz. Bu durumda pdbqt klasörüne giderek zinc atomunun değerliğini +2 ile manuel olarak değiştirmemiz gerekiyor.

2) Grid Parametre Dosyalarının Hazırlanması.

Figür 2. Grid Box oluşturulması.

“Grid -> Set Map Types -> Chose Ligand” kısmından ligandı seçtiğimizi belirtiyoruz, ardından “Grid -> GridBox” seçimini yaparak ekrana gelen “grip options” kısmından tekrar “Chose Ligand” seçimini yaparak gireceğimiz koordinatların ligand için geçerli olduğunu belirtiyoruz. Daha sonra x, y, z koordinatlarına, kristal yapıdaki TRICHOSTATIN A molekülünün ağırlık merkezi olarak belirlediğimiz koordinatları yazıyoruz. Burada dikkat etmemiz gereken bir diğer husus ise grid box dediğimiz Figür 2’de mavi ve kırmızı ile görülebilen 3 boyutlu yapının ligandın sığabileceği boyutlarda olması. Bu yapının fazla büyük ya da fazla küçük olması docking sonuçlarınızı etkileyecektir. Docking esnasında ligand bu kutu içerisinde pozisyon aramaktadır ve eğer fazla büyük, fazla küçük veya yanlış yerde belirlenirse sonuçlarınız maalesef olumsuz etkilenecektir. Bu işlemde yapıldıktan sonra “File -> Close Saving Current” seçimi yaparak .gpf (grid parameter file) dosyanızı ligand ve proteinin bulunduğu dosyaya kaydetmeniz gerekiyor.

3) Docking Parametre Dosyalarının Hazırlanması

Figür 3. dpf (Docking Paremeter File) dosyası için ligand ve proteinin belirtilmesi.

“Docking -> Macromolecule -> Set Rigid Filename” sekmelerinden makro molekülümüzü yani proteinimizi seçiyoruz ve bu seçim aynı zamanda docking esnasında proteinimizi sabitlemeye yarıyor peki neden proteini sabitliyoruz (Figüre 3)? Program çalışırken her bir adımda ligand molekülündeki hareket edebilecek, moleküle esneklik sağlayan ve belli açılara kadar esneyebilen noktalar program tarafından önceden tanımlanmıştır. Program bu noktaları farklı şekillerde, belli açılar içerisinde çevirerek ligand için proteinin içerisinde yeni pozisyonlar arar ve bu pozisyonlar için enerji hesaplamaları yapar. Bundan dolayı bir ligandta bu noktalardan ne kadar çok olursa docking işlemi o kadar uzun sürer. Ligandların aksine proteinde bu noktalardan yüzlerce sayıda olabilir. Bu yüzden zamandan kazanmak ve hesaplama yükünü azaltmak için ligand serbest, protein ise sabit bırakılır. Şimdi iste “Docking -> Ligand -> Chose Ligand” seçeneği ile ligandımızı seçiyoruz.

Figür 4. Lamarkian Genetik algoritma değerleri.

Ligandımızın ve proteinimizin docking esnasında nasıl davranacağını program da belirledikten sonra şimdi docking için bir genetik algoritma belirlemeliyiz. Docking işlemini daha iyi gerçekleştirebilmek ve optimum bağlanma modunu bulabilmek için birçok genetik algoritma geliştirilmiştir. Bu uygulamada Lamarckian Genetik algoritmasını kullanacağız. Genetik algoritma ile ilgili detaylı bilgileri ve Figür 4’teki seçeneklerin ne ifade ettiğini öğrenmek için buradaki makaleyi okuyabilirsiniz. Genetik algoritmayı seçip “accept” diyerek devam ettiğimizde program bize bir .dpf (docking parameter file) oluşturuyor. Bu dosyanın içinde şu ana kadar yaptığımız seçimlerin programın okuyabileceği bir formatta çıktısı var. Bu dosyayı da oluşturduğumuz diğer dosyaların içine kaydediyoruz.

4) Terminalden Docking işleminin başlatılması

Figür 5. Autogrid4 kullanılarak map dosyalarının oluşturulması.
Figür 6. Autodock kullanılarak docking işleminin başlatılması.

pf ve dpf dosyalarımızı oluşturduğumuza göre Autodock Tools uygulamasını artık kapatabiliriz. Şimdi bu dosyaları kaydettiğimiz dosyada bir terminal açıp, autogrid4 komutunu Figür 5’teki gibi çalıştırıyoruz. Autogrid bize map dosyalarını oluşturuyor bu dosyalar docking esnasında bize gereken dosyalar. Ardından Figür 6’da olduğu gibi şekilde Autodock komutunu çalıştırıyoruz.

Bu işlemden sonra Docking başlamış oluyor, yeni bir terminalde “top” yazarak işlemin çalışma durumunu takip edebilirsiniz.

5) Sonuçlar

Figür 7. result.dlg dosya içeriği.

İşlem tamamlanınca çalıştığımız klasörün içinde bir .dlg dosyası oluşturuluyor. Bu dosyada docking sonuçlarımız mevcut. Bütün sonuçları enerji cinsinden görmek isterseniz “CLUSTERING HISTOGRAM” başlığı altında bir tabloda bu değerleri görebilirsiniz. Daha detaylı sonuçları için dosyanın alt kısımlarına doğru “LOWEST ENERGY DOCKED CONFORMATION from EACH CLUSTER” olarak hazırlanmış bir kısım var burada karşımıza ilk gelen sonuç programın oluşturduğu protein-ligand kompleksleri içerisinde en düşük enerjiye sahip olan komplekse ait. Burada ΔG ve Ki değerlerini görebiliriz. Yazımızın başında deneysel olarak hesaplanan Ki değerini16.9 nM olarak söylemiştik biz ise burada 89.68 nM olarak bulduk, nanomolar seviyesinde bu değerler yaklaşık değerler olarak kabul edilebilir. Daha detaylı karşılaştırmak için bağlanma enerjilerine de bakabiliriz.

Enerjileri karşılaştırmak için Ki den ΔG’ye geçmemiz gerekiyor, bunun için kullanacağımız formül;

ΔG = -RTlnKi

Bu formülde R = 0.008314 kJ mol-1 K-1 ve T = 298,15 K değerlerini yerleştirirsek deneysel olarak gerçekleştirilen bağlanma enerjisini -7.02 kcal/mol olarak buluyoruz, bizim ise Autodock ile bulduğumuz sonuç -9.61 kcal/mol.

Autodock4 kullanarak deneysel olarak çıkan sonuca yaklaşık bir değer bulduğumuzu söyleyebiliriz. Şunu da unutmayalım bu işlemin laboratuvarda yapılması bir, bir buçuk saat sürmekte ve harcanan malzemeler (enzim, molekül ve assay kitleri) de cabası, biz bu değere yaklaşık bir değeri yaklaşık 5 dakika içerisinde bulabiliyoruz ve bu sadece bir molekül için. Docking çalışmalarının gün geçtikçe daha fazla tercih edilmesinin deki bir nedende bu. Bizler, bilgisayar destekli ilaç tasarımı ile uğraşan insanlar bu yöntem ile bir günde on binlerce molekülü bilgisayar ortamında tarayıp sonuç çıkartabiliyoruz ve bunu yaparken deneysel sonuçlara yakın değerlerde buluyoruz.

Bu konu ile ilgili öğrenilecek daha çok fazla detay ve öğrenilecek çok fazla şey var sizlere bildiğim kadarı ve elimden geldiğince anlatmaya çalıştım, Umarım bu yazı sizler için bilgilendirici olmuştur. Çalışmaya devam! 🙂

Referanslar

  1. Carrillo, A. K., Guiguemde, W. A., & Guy, R. K. (2015). Evaluation of histone deacetylase inhibitors (HDACi) as therapeutic leads for human African trypanosomiasis (HAT). Bioorganic & Medicinal Chemistry, 23(16), 5151–5155. https://doi.org/10.1016/j.bmc.2014.12.066
  2. Guedes, I. A., Pereira, F. S. S., & Dardenne, L. E. (2018). Empirical Scoring Functions for Structure-Based Virtual Screening: Applications, Critical Aspects, and Challenges. Frontiers in Pharmacology, 9. https://doi.org/10.3389/fphar.2018.01089
  3. Hill, A. D., & Reilly, P. J. (2015). Scoring Functions for AutoDock (pp. 467–474). https://doi.org/10.1007/978-1-4939-2343-4_27

Zarf Atmadan Ortalama İfade Mitine: Omik Alanının Çok Kısa Evrimi ve Tek Hücre Yöntemlerin Doğuşu

Açı/Görüş

“Gestalt: something that is made of many parts and yet is somehow more than or different from the combination of its parts”(0)- bir şey pek çok parçadan oluşsa da bütünün kendisi, bu parçaların birleşiminden fazlasını ifade eder.

https://www.merriam-webster.com/dictionary/gestalt

“Genomics, trancriptomics, proteomics, metabolomics…”, fakat nedir bu “-omics”?

Aslında bir alana dair bütünlüğü ifade eden bir kelime olarak kullanılan “omik(-omics)”in biyoloji literatüründe ilk kullanımları bir nevi “zarf atma (fishing expeditions)”(1) olarak adlandırılmıştır. Bir sonuca varmak için birbiriyle bağlantılı bir sürü olasılığın üzerinden yola çıktığınızı düşünürseniz, haklılık payı vardır.

Verilerle Doğan Yeni İhtiyaçlar

Maslow’un eğer bir biyolojik bilimler ihtiyaç piramidi olsaydı, en altta, merakla beraber bir kuşku ve soru gelirdi zannediyorum. Sonra hipotez, sonra veri, arada bir yerde teknik ve kapasite. Verilerle biriktikçe gelen ve geri dönütünü Mandelbrot seti gibi çoğalarak yapan ve kapsama alanı dışına çıkmayı hedefleyen ve aynı zamanda o alanı genişleten yepyeni cevaplar ve sorular piramitleri onu takip edebilirdi.

Çoklu tekniklerin gelişimi ile beraber, ve tabiki ona uygun istatistiksel methodlar, -omik temelli alanlara da bakış açısı değişmeye başlamıştır. Bir genin fonksiyonunu anlamak için sadece seçilen gen bağlamında kalan yöntemlerle, bütünü görmek o kadar kolay olmayabilirdi. Kaldı ki bazen bütünün kendisi, onu oluşturan parçaların birleşiminden büyük olabilirdi ki “kişiselleştirilmiş tıp (precision medicine)”ın doğumu da işte Gestalt-vari bu bakış açısını yansıtmaktadır demek yanlış olmaz sanırım.

Bir örnekle, İnsan Genom Projesi (Human Genome Project) tamamlanmaya yakın, fonksiyonel/işlevsel genomik (functional genomics) de ayrıca önem kazanmaya başlamıştır (2). İşlevsel genomik için temel felsefe olarak,bir genin/proteinin işlevini anlamak için, bütün genleri/proteinleri sistematik bir bakış açısı ile almak denilebilir.

Ve array(3) ile başlayıp sekanslama(4) teknikleri ile devam eden süreçte, bilgi birikimi de arttı ki burada eşlik eden bilgisayarların işlem gücü, kapasitesi, vs.den bunu bağımsız düşünmek imkansız. Öte yandan, bu koca bilgi yığını, bazı cevaplar verse de yepyeni soruları da beraberinde getirdi. Yeni cevaplar, yeni sorular, yeni teknikler, yeni cevaplar, yeni sorular… ve yeni alt alanlar… ve yeni sorular, yeni cevaplar…

Figür 1: 1 Ekim itibari ile “sequencing*” başlığı altında yayımlanan yıl başına düşen makale sayısı (Scopus). Hali hazırda İnsan Genom Projesinden sonra hızla gelişen tekniklerle beraber gelen dramatik artışı görmek mümkün. k=1000

Toplu mu Tek Tek mi?

Peki, ortalamaya dayanan bu teknikler ne kadar gerçeği yansıtıyordu? Yoksa, toplu sekanslama (bulk sequencing) yaklaşımları, bazı gerçekleri kaçırmaya mı neden oluyordu? “Ortalama hücre” sadece bir mit miydi (5)?

Bir toplumda her ne kadar aynı bölgede yaşayan her birey nasıl aynı olmayacaksa, aynı bölgeden alınan küme küme hücrenin ortalamasına dayalı yöntemlerde de bireysel farklılıkları yakalamak mümkün olmayacaktır. Bu da beraberinde tek hücre methodlarını (mesela tek hücre sekanslama,(6)) beraberinde getirmiştir.

Bir örnekle, gelişime genetiğine dair bazı ipuçlarını ve değişimleri tek hücre düzeyinde yakalamak, bağlı hastalıkları ya da yaşlanmaya ve buna çözüme dair yepyeni ipuçları saklayabilir. Veyahut eğer kansere sebep olan koskoca hücre topluluğu içinde belli bir alt küme ise, sadece bu kümeyi hedef alacak bir çözüm, belki daha isabetli bir yaklaşım olacaktır.Ya da sağlam kalmayı başaran ve etkilenmeyen diğer alt gruplar, yeni bir yaklaşım sunacaktır.

Figür 2: 1 Ekim itibari ile “single cell*” AND “sequencing*” başlığı altında yayımlanan yıl başına düşen makale sayısı (Scopus). Sahneye ilk 2011 yılında çıkan çoklu (transcript-wise and cell-wise high throughput) tek hücre methodları hala erken gelişim sürecinde ve buna rağmen son yıllardaki ilgili artışı gözden kaçırmak imkansız.

Öte yandan, bu kadar bilgiyi, teknoloji ile hesaplamalı biyoloji ve biyoenformatiğin gelişimine borçluyuz. Fakat algoritmaların “ön yargıları”ndan da hala uzak değiliz. Bu karmaşadan yeni aydınlıkları, yeni mitler (mesela gerçekten tek hücre bir çözüm mü sunuyor yoksa yeni bir mit mi?) ve yeni arayışları yaratmak için geniş ufuklar, ve farklı bakış açılarına ihtiyaç bulunmaktadır.

Referanslar:

0- Definition of GESTALT. (n.d.). Retrieved October 2, 2020, from https://www.merriam-webster.com/dictionary/gestalt

1- Weinstein, J. N. (1998). Fishing Expeditions. Science, 282(5389), 627–627. https://doi.org/10.1126/science.282.5389.627g

2- Hieter, P., & Boguski, M. (1997). Functional Genomics: It’s All How You Read It. Science, 278(5338), 601–602. https://doi.org/10.1126/science.278.5338.601

3- Lockhart, D. J., & Winzeler, E. A. (2000). Genomics, gene expression and DNA arrays. Nature, 405(6788), 827–836. https://doi.org/10.1038/35015701

4- Wang, Z., Gerstein, M., & Snyder, M. (2009). RNA-Seq: A revolutionary tool for transcriptomics. Nature Reviews. Genetics, 10(1), 57–63. https://doi.org/10.1038/nrg2484

5- Levsky, J. M., & Singer, R. H. (2003). Gene expression and the myth of the average cell. Trends in Cell Biology, 13(1), 4–6. https://doi.org/10.1016/S0962-8924(02)00002-8

6- Tang F, Barbacioru C, Wang Y, Nordman E, Lee C, Xu N, et al. (May 2009). “mRNA-Seq whole-transcriptome analysis of a single cell”. Nature Methods. 6 (5): 377–82. doi:10.1038/NMETH.1315.

Örneklerle Primer Dizaynı

Covid19 ile hiç duymamış olanların bile öğrendiği bir lab tekniği olan, moleküler bioyolojide yeni bir devir açan Nobelli teknik PCR (Polymerase Chain Reaction)’dan esinlenen bir method olarak kullandığımız qPCR (quantitative PCR)’ın temelinde iyi bir primer dizaynının yattığını söylemek yanlış olmaz sanırım. Kısaca, hedeflediğiniz sekansı çoğaltmak için baştan ve sondan 15-25 nucleotid dizisi uzunluğundaki “primer”leri polimeraz enzimi için başlangıç dizisi olarak kullanıyoruz.

Bir labda çalışmaya başladıktan sonra belki ilk biyoenformatik deneyiminizi gerçekleştirmenizi sağlayan NCBI-BLAST’tır. Peki, bu yoğun bilgi taşıyan siteden nasıl amaçladığımız bilgi ile çıkacağız?

Lablarda sıkça kullandığımız qPCR gibi teknikler için primer dizaynına dair bazı püf noktaları sizlerle paylaşacağım.

NCBI ile hedef genimizle ilgili detaylara ulaşma

NCBI ana sayfaya gittkten sonra “Search” (Arama) kutucuğuna genimizin ismini yazarak (ACTB genini örnek seçtim), “Gene” sekmesi altında aratıyoruz.

Figür 1: NCBI ana sayfaya gittkten sonra “Search” (Arama) kutucuğuna genimizin ismini yazarak (ACTB genini örnek seçtim), “Gene” sekmesi altında aratıyoruz.

Daha sonra karşımıza bir süre seçenek çıkıyor. Bunlar aslında diğer canlılarda insandaki bu genin karşılığı olanlar (ortholog) ya da varsa eski bir zaman diliminde ikilenmiş (duplication) ve belki sadece sekans değil işlev (function) olarak da farklılaşmış insandaki benzer genler (paralog)a sizleri yönlendiren bir sayfa bu (neyden bahsediliyor diyenler için link).

Figür 2: İnsan ACTB geni ile ilgilendiğimiz için homo sapiens ACTB ile devam edeceğiz.

Burada ilgili genle ilgili pek çok bilgiye erişmeniz mümkün. Exonic intronic bölgeler, genin bulunduğu kromozom, tam lokasyonu, Expression kısmında hangi dokularda ifade olduğunu, veyahut hangi fenotiple ilişki içinde olduğunu, tek nüklotit varyantlarını (SNPs), vs. pek çok detayını öğrenmek mümkün (bu noktada bir diğer alternatif UCSC Genome Browser olacaktır).

Figür 3: Tam lokasyon ve hangi kromozom.

Biraz daha aşağı inerseniz, bu genin tüm transcriptlerini (buradan ifade olunan RNAlar) görebilirsiniz.

Figür 4: Bu genle ilişkili bir transcript var. Şimdi üzerine tıklayıp ona gideceğiz.

Şimdi ilgili genle ilgili mRNAnın detaylarına aslında NCBI-Gene yerine NCBI-Nucleotide kısmından da erişilebilir olduğunu göreceksiniz.

Figür 5: mRNA ile ilgili detaylar. Aşağı kaydırırsanız CDS (Coding Sequence/Rergion)la ilgili detaylı bilgi edinebilirsiniz.

Burada önümüze iki seçenek çıkıyor. Birinci sağdaki pembe kutu ile gösterilen Pick Primers seçeneği ile Primer-BLAST‘a yönlenip oradan primer dizayn etmek, ikincisi ise sol üst köşedeki kahverengi kutudaki FASTA seçeneğine tıklayıp, ATCG harflerinden oluşan sekansı kopyala yapıştır yaparak başka primer dizayn araçlarını da denemek (mesela Primer3). Her ikisini de deneyeceğiz.

Primer-BLAST

Pick Primer dedikten sonra sizi şöyle bir sayfaya yönlendirecek:

Figür 6: Primer Blast, primer dizayn online aracı. Primer kriter seçimi.

Buradan sonra primerinizle ilgili bazı değerleri değiştirebiliriniz. Sağ yanlarındaki soru işaretine tıklayarak, her bölmenin hangi değişken için olduğunu detaylı bir şekilde öğrenebilirsiniz. Biz şimdi kısaca birkaç tanesini ele alacağız.

PCR product size ile tam olarak pcrda çoğaltmak istediğiniz hedefin uzunluğunu kısıtlayabilirsiniz. Bu noktada, qPCR’da kullandığımız SYBR-Green vs.nin en fazla 500bp hedef uzunluğu olmasına rağmen, 100-200 arası bir hedef ile optimumu olduğunu unutmamanızı öneririm.

Turuncu karedeki özellikle, aradığınız özelliklere uygun primer sayısını sınırlayabilirsiniz. Mesela, bana sadece ilk 10 tanesini göster gibi.

Mavi karedeki özellikle de primerinizin erime sıcaklığı /Tm) özelliklerini seçebilirsiniz. Tm en düşük 57, en fazla 63 olan ve aralarında en fazla 3 derece erime sıcaklığı farkı bulunan primerleri seçmek istiyorum gibi.

Yeşil karedeki özellikle de aradığınız primerin rastgele bir gen bölgesini mi yoksa exon-exon birleşimini hedef seçmek istediğinizi seçebiliyorsunuz. Amacınıza göre değişmekle beraber, eğer hiç bilmeden bu işe giriyorsanız, direk exon-exon tarayan seçeneğini seçmenizi öneririm (detaylı bilgi).

Kahverengi karedeki “submit” seçeneği ile ne olacağını görebilirsiniz. Burada “show results in a separate window” ile ayrı bir pencerede işleminizi gerçekleştirip, değişiklik için parametre değiştirme penceresini olduğu yerde bırakabilirsiniz.

Eğer ki daha fazla parametre ile ilgili bilgi sahibi iseniz, submit butonu aşağısındaki “advanced parameters” seçeneği ile diğer seçenekleri de düzenlemek mümkün.

Figür 7: İleri parametreler, primer algortiması değişimi, GC içeriği, vs.

İleri parametrelerde de özellikle “primer size”(primer uzunluğu) ve primer sekansı içerisindeki GC miktarı (yüzde olarak) (“Primer GC content), size göre optimize etmek mümkün. (Ben bu noktada GC için 40-60, primer çifti uzunluğu için de 18-20-23 seçeneği tercih ettim. GC-AT farklılığı bağ sayısına bağlı olarak primerlerin verimliliğini değiştirebilir.)

Submit ettikten sonra, şu şekilde biraz bekleyeceğiz.

Figür 8: Submit ettikten sonra, işlem için beklerken.

Evet, daha sonra çıkan sayfada, primerinizin tam olarak nereyi çoğaltacağını ve diğer özelliklerini (bağlanma sıcaklığı, kendi kendine birleşiyor mu, diğer primerle birleşiyor mu vs. gibi) bulacaksınız.

Figür 9: Primer dizayn algoritması açlıştıktan sonra önerilen primerleri görselleyen grafik.

Siyah kutucuklar, adı üstünde exonlar. Sarı, içi boş kutucuk da exon-exon bölgesini tarayan bölgelerden birini gösteriyor. Kırmızı kısım, protein-kodlayan kısmını. Aşağısındaki iki küçük mavi çizgi de primer dizayn aracının verdiğimiz kritere göre bulduğu iki çeşit primer çiftinin çoğalttığı hedef bölgesini. Öte yandan, transcriptin sonunu hedeflemek istemiyoruz. Çünkü rnalar bozunuma uğruyor (degredation). Bu da özellikle 3′ (sağ uç) sonu etkiliyor. 5′ (sol uç) ise bi tık daha güvenli. O yüzden primerlerimiz biraz daha sol uca yakın olsa daha iyi olabilirdi.

Primer çiftlerimizin ikisi de şimdilik kriterlere uygun gözükse de bakalım gerçekten aradığımız gibi mi?

Figür 10: Detaylı primer çitfi raporu.

Primer çifti raporun baktığımızda görüyoruz ki primerin çoğaltacağı hedef uzunluğu 162 ile ideal sınırlar içerisinde (100-200). Exon-exon birleşim bölgesinde. Primer uzunlukları da ideal: 19 ve 20. Tm de 60<= civarı. GC içeriği de (çünkü AT, GC oranı benzer olmasa bu da bağlanmadan kaynaklı farklılıklar oluşturabilir) 40-60% aralığında. Biraz kendi kendine (self-complementarity), bağlanma ihtimali var (istenmeyen primer dimers), ama o da kabul edilebilir oranda diyebiliriz. Ancak, aşağıda tüm varyantlar dahil diğer olası hedefleri gösteren (mesela başka bir transcripti hedef alıyorsa, actb yerine, bu sefer çıkan sonuçtaki miktarın o gene ait olup olmaycağını bimediğimiz için sıkıntılı bir durum.) bir liste var primer çiftleri için.

Ve maalesef hedef dışı transcriptler görüyoruz, bu primer çiftleri ile çoğalabilecek. Bunu, in silico PCR ile doğrularsak eğer, bu durumda bu primer çiftleri, maalesef uygun olmayacak. Yeniden dizayn etmemiz gerekecek. Bu durumda ya kendiniz dizayn edebilirsiniz ki bu aşırı yorucu bir süreç, ya da alternatif diğer araçları (benim favorim primer3) kullanabilirsiniz.

Primer3

Sizi primer3′de şöyle bir sayfa karşılayacak, burada sarı okla gösterdiğim bölgeye NCBI’dan kopyala yapıştır ile mRNA FASTA sekansı yapıştırın:

Figür 11: Primer 3 giriş, mRNA fasta sekansı yapıştırma (en üstteki task olarak generic seçiyorum).

Ve tabiki burada da primer uzunluğu (primer size), hedef uzunluğu (target size), GC %, minimum-maximum Tm değerleri gibi değiştirebileceğiniz faktörler var. Biraz aşağı inerseniz aynı sayfada, şunları görebilirsiniz:

Figür 12: Genel Primer Seçim Kriterleri. Turuncu kutucuk, primer uzunluğu; sarı kutucuk, primer Tm; yeşil kutucuk, GC oranı; kırmızı kutucuk, kaç tane aday versin algoritma bize.

Seçimlerinizi yaptıktan sonra “pick primers” e basarsanız, şöyle bir sonuç alacaksınız:

Figür 13: Primer 3 sonuçları

Sarı kutuda ilk primer çitfinin detayları ve kırmızı kutuda, hangi bölgesini hedeflediğini gösteriyor.

Aşağı indiğiniz takdirde ise alternatif 9 aday primer çifti daha görebiliyorsunuz.

Figür 14: Max return seçeneği ile sayısını belirlediğimiz 9 alternatif primer çifti.

Daha önce sol uca yakın seçmek istediğim için, 100-200 aralığındaki 2. alternatif dikkatimi çekti (ancak 1. ve 8.yi de alternatif olarak deneyeceğim eğer 2de arzuladığım sonucu alamazsam). In silico PCR ile tam olarak doğru olup olmadığını tespit edeceğim. (Bu arada diğer parametre seçenekleriyle ilgili bilgilere, mavi renkli başlıklarına tıklayarak ulaşabilirsiniz.)

In silico PCR

qPCR yapıp bir sürü materyali kullanmadan önce, programların dizayn ettiği primer çiftlerinin gerçekten hedefimizi mi yoksa başka bir şeyleri mi çoğalttığını görmek istiyoruz.

Figür 15: UCSC In Silico PCR aracı seçim sayfası.

Öte yandan exon-exon bağlantısı tarıyor seçeneğini primer3’de seçememiştik. Burada konfirme edeceğiz. Eğer arada en az bir intron varsa, ve yaptığımız PCRdaki hedeften daha uzun bir sonuç elde etti isek (agarose jelde yürüterek tespit edebilirsiniz), bunun sebebinin bir dna kontaminasyonu olduğunu tahmin edebiliriz (teoride transcriptte intron beklemiyoruz). Kısacası, PCR tüm çabalara rağmen çalışmadığı takdirde, bunun sebebine dair bize ipucu sunabilir. Öte yandan, eğer ki başka hedefleri de çoğaltıyorsa (multiple targets), bu durumda bunu UCSC’un in silico pcr ile dry-lab (bilgisayar üzerinden) görmek mümkün.

Figür 16: In Silico PCR aracı, görünüm.

Hangi canlı genomundasa ilgili transcript, onu seçiyoruz. Sonra en son (latest) “assembly” yi seçiyoruz. Seçilen baş ve son uç primer çiftimizi kopyala yapıştır yapıyoruz.

Figür 17: In Slico PCR sonucu.

In silico PCR sonucunda gördük ki hedefimiz 7. kromozomda, ACTB genimizin bulunduğu lokasyonda bir yerleri çoğaltıyor. Ve tek hedefi var. Üstelik, arada en az bir intron var (exon-exon taradığına emin olduk), çünkü qPCR hedefimizin gittiği gende taradığı bölge hedefin kendisinden uzun (182 vs. 632).

Referans Gen

qPCR’ı gen ifadesini ölçmek için yaptık. Öte yandan, hedef genlerimizin yanı sıra, örneklerdeki gen ifadelerindeki farklılığın gerçekten bizim değiştirdiğimiz durumdan ötürü (mutasyon, bir ilaç vs. olabilir bu) mü yoksa aslında bazı teknik hatalardan (örnekleri eşit miktarda koymamak vs.) mı kaynaklandığını görmek için referans gen/mRNA adı verilen (reference or housekeeping) başka genleri/mRNAları de kontrol ederiz.

Burada dikkat edilmesi gereken unsur, bu seçilen referansın, her dokuda ve her durumda, etkilenmeden aynı derecelerde ifade olmasıdır.

Bu sebeple eskiden beri Actin ve GAPDH gibi genler referans seçilirdi. Ancak son yıllardaki çalışmalar gösterdi ki bu genler de o kadar sabit bir ifade profili sergilemiyor. Bu yüzden şimdilerde çalıştığınız durum için (çeşitli kanser türü ya da yaşlanma olabilir) en uygun referansı seçmek için literatürü sıkı bir takip öneririm.

Kanser türleri için tek tek referans gen için bir liste barındıran şu makale ile:

Conventionally used reference genes are not outstanding for normalization of gene expression in human cancer research (burada önerilenler: • HNRNPLPCBP1RER1)

bu konuda diğer ufuk açıcı bilgiler sunan bu makaleyi tavsiye ederim:

Human housekeeping genes, revisited

Kısa kısa qPCR sonuç hesaplama

(Daha önce hazırlamış olduğum örnek taslağı sizle de paylaşıyorum.)

qPCR sonuçlarını analiz ederken neyi görmek istiyoruz? Göreceli ifade edilmeyi (yani, A geni, B genine göre 10 kat artmış vs gibi) mi yoksa mutlak değerleri mi (A geni, şu kadar ifade edilmiş, B geni de bu kadar vs. gibi)? Öncelikle bunun ayrımını yapıyoruz. Göreceli ifade edilmede de yine kontrol genleri kullanıyoruz ki her bir geni birbiriyle kıyaslayabilelim.

qPCR ile veri analizinde, bir  2^(-𝚫CT), 2 üzeri delta Ct demek, methodu var bir de 2^(-𝚫𝚫CT), 2 üzeri delta delta Ct diye okunur, methodu var.

ÖrneklerReferans gen ve baktığımız hedef gen
CTb-actin (reference/housekeeping)CTgtg1l3
kontrol (sağlıklı)18.017.0
deney (hastalıklı)19.014..0
Tablo 1: Örnek qPCR sonucu elde edilen Ct değer tablosu
  1. method [2^(-𝚫𝚫CT)]

İlk önce hedef genimizi/gbtg1l3) referansa(b-actin) göre normalize ediyoruz. Daha sonra hasta Ct değerini sağlıklıya göre normalize ediyoruz. Sonra da ifade edilme oranını buluyoruz (fold-difference):

𝚫CT (sağlıklı) = 𝚫CT(gbgt1l3) – 𝚫CT(b-actin)

𝚫CT (sağlıklı) =  17-18 = -1.0

𝚫CT (hasta) = 𝚫CT(gbgt1l3) -𝚫CT (b-actin)

𝚫CT (hasta) = 14-19 = -5

𝚫𝚫CT= 𝚫CT(hasta) -𝚫CT(sağlıklı)

𝚫𝚫CT= -5 – (-1) = -4

2^(-𝚫𝚫CT)= Normalize edilmiş ifade = 2^(-4) = 16

Bu ne demek? Hastamızda gbgt1l3 geni 16 kat daha fazla ifade edilmiş (sağlıklıya göre).

         2.  method [2^(-𝚫CT)]

Burada da ilk önce  her bir örnek için(hasta vs. sağlıklı) ilgili genlerin (gbgt1l3 vs. bactin) göreceli ifade edilmesini hesaplıyoruz. Şöyle:

2^(𝚫CT of bactin – 𝚫CT  of gbgt1l3) = Göreceli ifadeyi burdan buluyoruz.

Sağlıklı için = 2^(𝚫CT of bactin – 𝚫CT  of gbgt1l3) = 2^(18-17) =21=2

Hasta için = 2^(𝚫CT of bactin – 𝚫CT  of gbgt1l3) =2^( 19-14) =25= 32

Sonra da bu ifadeye karşılık gelen ifade oranını hesaplıyoruz. Şöyle:

Sağlıklının ifadesi = sağlıklı/sağlıklı =2/2=1

Hastanın ifadesi = Hasta / sağlıklı = 32/2=16 kat artan bir gbgt1l3 ifadesi var.

Ekler

Dokularda gen ifadesi

Bu arada geniniz hangi dokularda daha çok ifade oluyor, hangi hastalıklarla ilgili vs. gibi bilgi edinmek isterseniz, kısa kısa GeneCards ve ExpressionAtlas‘tan istifade edebilirsiniz.

Primer Verim Hesabı

Bunlardan ayrı olarak bir de verimi hesaba katarak yaptığımız ölçümler var. Verimden kastım nedir? Bu primerler nasıl çalışıyor? Yani PCR’da ilgili genle eşleşen bu primerler, her cycle (döngü)da gerçekten iki katına çıkarıyor mu genimizi bilmiyoruz. Yukarıdaki metodlarda, iki katına çıkararak güzelce çalıştığını/ya da gbgt1l3 ve bactin primerlerinin aynı verimde çalıştığını varsaymış olduk. Ama öyle mi?Aslında her primeri, ne kadar iyi çalıştığı konusunda test etmemiz lazım. Bunu da elimizdeki primerleri değişik miktarlarda dilüe edilmiş cDNA’larla deneyerek (serial dilution) hesaplayabiliyoruz.

Neden dilüe ediyoruz? Şöyle ki eğer ben bu primerlerin karışımdaki oranını yarıya indirirsem ne olur? Benim primerlerimin miktarı da yarı yarıya düşecektir. Eğer ki 4 katı düşürürsem ne olur? Her seferinde ilgili karışım, treshold/sınır (Ct) değerine daha geç ulaşacak demektir. Ya da bunun tam tersini (artırmak) düşünebilirsiniz.

Sonra çıkan değerleri GraphPad/excel’e koyacağım ve yatay bir eğri/çizgi elde edeceğim. Bu ne demek? Böyle güzel bir çizgi, primerlerimin güzelce çalıştığının bir kanıtı.

R: correlation yani ilişkiyi gösterir. Burada ilişki değerinin +/-1’e yakın olması, primerlerin ilgili geni her döngüde (cycle) 2’ye katladığının kanıtıdır.

Neden log?

Çünkü

 log22 =1 

 log24=2 

 log21/2= -1

 log21/4=-2 

….

Yani, ikiye katlandığında bir fold-change alırsınız. Yarıya düşürdüğünüzde -1 fold-change olur. 2 katına çıktığınızda 2 fold-change olur.

Ya da seri dilüsyonda uyguladığınız metoda göre log10’i de kullanabilirsiniz.

Kısacası, katlanma:/azalma vs. gibi durumlar için belli bir aralıkta, düzgün (straight) bir ilişki (correlation/R) çizgisi elde edebilirsiniz.

Teşekkür

Yüksek lisansım boyunca üyesi olduğum ve bana her açıdan katkı sağlayan, değerli hocam Özlen Konu ve Konu Lab‘da en basit işlerden en komplex analizlere kadar bende emeği geçen çok kıymetli dostlarıma (özellikle Ayşe G. Keşküş, Said ve Seniye Targen) teşekkürlerimi sunarım.

References

  • Nobeli PCR: https://www.nobelprize.org/prizes/chemistry/1993/mullis/lecture/
  • NCBI websitesi: https://www.ncbi.nlm.nih.gov/
  • Ortholog/paralog: Jensen, R.A. Orthologs and paralogs – we need to get it right. Genome Biol 2, interactions1002.1 (2001). https://doi-org/10.1186/gb-2001-2-8-interactions1002
  • Exon-exon junction: https://sg.idtdna.com/pages/education/decoded/article/use-splice-junctions-to-your-advantage-in-qpcr
  • Primer3: http://bioinfo.ut.ee/primer3/
  • UCSC: https://www.genome.ucsc.edu/index.html
  • In silico PCR: https://www.genome.ucsc.edu/cgi-bin/hgPcr
  • Eisenberg E, Levanon EY. Human housekeeping genes, revisited [published correction appears in Trends Genet. 2014 Mar;30(3):119-20]. Trends Genet. 2013;29(10):569-574. doi:10.1016/j.tig.2013.05.010
  • Jo, J., Choi, S., Oh, J. et al. Conventionally used reference genes are not outstanding for normalization of gene expression in human cancer research. BMC Bioinformatics 20, 245 (2019). https://doi-org/10.1186/s12859-019-2809-2
  • qPCR makalesi: Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-408. doi:10.1006/meth.2001.1262
  • GeneCards: https://www.genecards.org/
  • ExpressionAtlas: https://www.ebi.ac.uk/gxa/home
  • Primer Verim Hesaplama: http://www.sigmaaldrich.com/technical-documents/protocols/biology/qpcr-efficiency-determination.html
  • Örnek bir primer verim hesaplama grafiği: https://www.novusbio.com/products/afm-primer_nbp1-71653

Lewontin Paradoksu ve Düşündürdükleri – Ergi Deniz Özsoy

Presenter

Ergi Deniz Özsoy

Ergi Deniz Özsoy 1967 yılında Hannover’da doğdu. 1993 yılında Hacettepe Üniversitesi Fen Fakültesi Biyoloji Bölümü’nü bitiren Özsoy, 1996 yılında yine aynı bölümde yüksek lisans tezini vererek bilim uzmanı oldu. 2002 yılında Hacettepe Üniversitesi Biyoloji Bölümü‘nde doktorasını tamamladı. Doktora deneylerini Groningen Üniversitesi GenetikBölümü Popülasyon Genetiği biriminde aldığı TÜBİTAK bursuyla tamamladı. 2000 ve 2002 yıllarında Kuzey Karolina Üniversitesi’nde istatistiksel genetik üzerine eğitim aldı. 2004 yılından itibaren çeşitli sürelerle aynı üniversitede Trudy Mackay’ın laboratuvarında kantitatif genetik ve genomik çalıştı. 2010 yılında Fullbright bursiyeri olarak Kaliforniya Üniversitesi San Diego’da Ekoloji ve Evrimsel Biyoloji Bölümü’nde araştırmalarda bulundu. Şu an Hacettepe Üniversitesi Biyoloji Bölümü’nde genotip-fenotip ilişkisinin karmaşık genetiği ve genomiği üzerine evrimsel genetik perspektif kullanarak Drosophila modelleri çerçevesinde çalışmaktadır. Ek olarak egzersiz genetiği ve genomiği, gelişim genetiği ve çeşitli genetik temelli hastalıkları genomdaki genetik varyasyonla ilişkisinin araştırılması gibi çalışmalarda yürütmektedir.
Evrimsel biyolojigenetikgenomik ve kantitatif genetik Özsoy’un çalışma alanlarıdır. Özsoy, evrimsel biyolojinin tarihi ve evrim felsefesi ve biyoloji felsefesi konularıyla da ilgilenmektedir. Bu konularda yurt içinde ve yurt dışında yayınlanmış makaleleri bulunmaktadır.

Özet

Bir türün sahip olduğu genetik çeşitlilik miktarının genellikle, nötral (seçilimsel olarak birbirine eş) mutasyonların birikmesiyle oluştuğu düşünülür. Nötral evrim kuramına göre, nötral mutasyonların genetik sürüklenme ile birikmesi sonucunda oluşan heterozigotluk (genetik çeşitlilik) ile populasyonların etkin (efektif) büyüklüğü arasında doğrusal bir ilişki olmalıdır: popülasyon büyüklüğü arttıkça nötral mutasyonların birikme ihtimali de artar ve genomik heterozigotluk düzeyiyle, dolayısıyla, popülasyon büyüklüğü doğru orantılıdır. Bununla birlikte, ilk defa tüm açıklığıyla çağımızın büyük evrimsel genetikçisi Richard Lewontin’in analizinin işaret ettiği gibi, bu ilişki bir yanılsamaya dayalı olabilir ve yapılan pek çok çalışma büyük popülasyon-düşük genetik varyasyon ya da düşük genetik varyasyon büyük popülasyon büyüklüğüne sahip pek çok türe ve tür-içi (popülasyonlar arası) farka işaret etmektedir. Popülasyon büyüklüğü ile nötral genetik çeşitlilik arasındaki bu çelişki- evrimsel biyoloji literatüründe Lewontin Paradoksu olarak anılmaktadır ve evrimsel biyolojinin zorlu problemlerinden biri olarak aktif araştırma konusudur. Bu konuşmada, Lewontin paradoksunun çözümüne işaret eden modern çalışmalar ve yaklaşımlar, klasik Hill-Robertson etkisinin genişletilmiş bağlamında, “bağlantılı seçilim (linked selection)” sürecine vurgu yapılarak özetlenecektir.

Tarih: 8 Ağustos 2020 – 18:00 (GMT+3)

Dil: Türkçe

Aşağıdaki linkten webinara kayıt olabilirsiniz:

https://www.bigmarker.com/bioinfonet/Lewontin-Paradoksu-ve-Dusundurdukleri

AMBER kullanarak Moleküler Dinamik Simülasyon

Moleküler Dinamik Simülasyon Nedir ?

Moleküler dinamik (MD) simülasyonları, kabaca tabir etmek gerekirse, temeli klasik mekanik olarak da adlandırılan Newton’nun hareket kanunlarını kullanarak (Newton’s laws of motion) bir protein veya molekülün atomlarının zamana göre hareketini tahmin eder. Gününümüzde çok sıklıkla başvurulan bir yöntem olmasına rağmen geçmişi 1950’lere kadar dayanıyor. 1950’lerin sonunda, B. J. Alder and T. E. Wainwright tarafından ilk MD simülasyon basit gazlar üzerinde denenmiştir. Sonrasında ise 1977 sonlarında ilk defa proteinler üzerinde çalışılmaya başlanmıştır. Günümüzde bu simülasyonların kullanımını daha çok mümkün kılan üç isim Martin Karplus, Michael Levitt and Arieh Warshel “for the development of multiscale models for complex chemical systems.” çalışmalarından dolayı 2013 Nobel Kimya ödülüne layık görülmüştür (bknz. The Nobel Prize in Chemistry 2013).

Peki neden biz bu tür bir çalışmaya ihtiyaç duyduk ? Buna bir sürü yanıt verilebilir ama basit bir cevap verecek olursak. Proteinlerin 3 boyutlu yapılarının elde edildiği X-ray kristalografi, NMR veya Cryo-em gibi yöntemlerin, hücre içi reaksiyonların çok hızlı gerçekleşemsinden kaynaklı olarak, belirli deneysel metodlarla proteinlerin reaksiyon öncesi ve sonrasındaki yapıları elde edebiliyor olması ve reaksiyon için gerekli olan konformasyonel değişimleri yakalamıyor olması, bizim bazen reaksiyonlar ve hücre içi iç dinamiğin nasıl işlediği hakkında soru işaretleri meydana getiriyor. Tabiki de bu durum proteinden proteine farklılık göstermektedir. Ayrıca bu çalışmalarının zahmetli ve uzun deneyler gerektiriyor. Ufa bir örnek verecek olursak, GTP hidrolizini yapan proteinlerin (aynı zamanda GTPase de denir), reaksiyon için gerekli olan konformasyonu, hidroliz olmayan GTP kullanarak elde edilir. Burada elde edilen konfromasyonun gerçekten de reaksiyon için gerekli olan konformasyon olup olmadığı tartişmaya açıktır. Bu yüzden çok sık tartışmaların döndüğü örnekler literatürde vardır. MD kullanımını neden gerekli olduğunu anlatmak için bir sürü örnek verilebilinir ama basit bir örnek olarak bu verilebilir.

MD için biraz daha bilgi vermek gerekirse, MD sistemleri hızlıdır ve parametriktir. Yani sistemdeki atomlar ve atomlar arsındaki bağlar belirli parametrelere göre tanımlanır. Aynı zamanda toplam enerji korunur. MD’de kovelent bağ kırılması veya oluşumu gözlenmez. Atomları tanımlayan parametreler de genel kimya ve fizikten de bilenen 5 temel enerji hesabı ile tanımlanır. Bunlar bağ gerilimi (bond stretching), açı bükülümü (angle bending), torsion dedimiz dönmeler, elektrostatik kuvvetler ve van der Waals kuvvetlerdir. Bu parametreleri de içeren atomların MD için kullanılacak özelliklerini içeren verilerin bütününe de force-field adı da veriliyor ve birden fazla force-field bulunabiliyor örneğin AMBER force-field, CHARMM force-filed. Çalışmalara göre uygun olanı kullanılabilir.

MD simulasyonun temel işleyişi sırasıyla şöyledir. İlk olarka sistemin potansiyel enerjisi ilgili force-field kullanılarak hesaplanır. Bu enerjinin pozisyona göre türevi, o pozisyondaki kuvveti elde etmemize yarar. Bu kuvvetten de Newton mekaniğinden ivmeye, ivmeden de belli bir zaman aralığındaki hız değişimine gidilir. Bu hız değişiminden de yeni pozisyona gidilir. Sonuç olarak dt kadar bir zaman aralığındaki hız ve pozisyon değişimi hesaplanmış olur. Aşağıda işlemlerin matametiksel ifadelerini sırasıyla bulabilirsiniz.

Şimdi yukarıdaki işlemler MD temel mantığı ve nasıl ilerlediğidir. Bizim n atomlu bir sistemimizde 3n tane kordinatımız olacak. Bundan dolayı analitik çözüm pek mümün değildir ve nümerik çözüm uygulanır. Bunun için de “time symmetric” integrasyon metoduları dediğimiz metodlar kullanılır örneğin Leapfrog ve Verlet. Bunların ayrıntılı bilgisi için Andrew R Leach – Molecular modelling principles and applications (2001) kitabını inceleye bilirsiniz.

AMBER’de MD Simülasyon Örneği

  • Pdb dosyasının hazırlanması

Burada basit bir şekilde bir Protein Data Bank üzerinden alınan bir protein için simülasyon basit başlatırken neler yapmalıyız ona bakacağız. Bunun için ise kullanacağımız PDB kodu 1L1D (https://www.rcsb.org/structure/1l1d). İlk olarak kullanılan proteinin aktif halinin monomer mi dimer mi veya türevleri şeklinde çalışılıp çalışılmadığının bilinmesi gerekiyor. Çalışacağınız protein hakkında ne kadar bilginiz olursa Moleküler Dinamik Simülasyonunu o kadar iyi uygulayabilirsiniz. Pdb formatındaki yapı -bizim şuan kullanacağımız yapı gibi- X-ray kristalografiden elde edilen tekrarlı yapılar olabilir. Bu yüzden resim 1’de göründüğü gibi yapıdan fazladan chain görülebilir. Bu chaine ait olan her şeyin silinmesi gerekiyor. Bunu text editör yardımı ile veya pymol gibi programlar kullanarak yapabilirsiniz. Bizim sistemimiz için B chainini ve onun içerdiği her şeyi sildik. Ayrıca sistemde kristalografi de kullanılan bufferdan kalan moleküller olabilir bunların da silinmesi gerkiyor. Dikkat edilmesi gerekilen bir husus, bir amino asit zincirinin bitiğini ve yeni bir yapının başladığını -bu yeni bir chain, su molekülleri ya da bir ligand olabilir- AMBER’in anlayabilmsi için PDB dosyasında ilgili chainin sonunda “TER” bulunması gerek. Ayrıca yapıda olmayan amino asitler varsa bunun homoloji model veya abinitio gibi yöntemlerle modellenmesi gerekmektedir. Bizim sistemimiz için böyle bir şeye ihtiyaç yok ve kristal yapıda eğer su varsa bunların tutulmasında yarar vardır. Pdb dosyasın en sonunda bazen “CONNECT” ile başlayan bağları tanımlayan ifadeler bazen AMBER için yanlışlıklara neden olabileceğinden silmeliyiz. Sonuç olarak pdb dosyamızın içinde sadece olmasını istediğimiz yapıların kalmasını istiyoruz ve gerisini siliyoruz. Bizim sistemimiz için bunlar su molekülleri ve proteinin A zinciri.

Bunun yanında, sistemde standart olmayan amino asitler varsa ve eğer bu standart olmayan amino asitler sistemimiz de olamsını istediğimiz bir durum ise parametresinin eklenmesi gerekiyor. Aynı zaman da bir ligand ile çalışma yapacağımız zaman da parametrelerinin eklenmesi gerekecek. Bunun için çeşitli yöntemler var (bknz. CGenFF). Eğer istenmeyen bir durum ise bunu standart haline çevirmemiz gerekmektedir. Bizim proteinimizde metiyoninler, selenometiyonin olarak gözüküyor. Burada bir text editör yardımıyla pdb içinde “MSE” olarak yazılmış amino asitleri metiyonin AMBER için standart ismi olan “MET” ile değiştirmemiz ve selenyum içeren atomunun olduğu satırı silmeliyiz. Burada sildiğimiz atomun yerine sonradan AMBER kendisi kükürt atomunu koyabildiğinden yerine bir şey yazmamız gerekmiyor. Aşağıda bir örnek verilmiştir. Bu işlemi bütün “MSE” olan amino asitlere yapmamız gerekiyor.

  • Protonasyonların Tanımlanması

Bundan sonraki aşamada ise bazı iyonize olabilecek amino asitlerin protonasyonlarının düzenlenmesi olacak. Bu kısım biraz uzun ve zahmetli olabiliyor. Bu yüzden otomatik yapan programlar mevcut örneğin Charmm-gui, fakat burada uzun anlatımını yapacağız. Protonasyonu belirlememiz için iyonize olabilecek amino asitlerin pKa değerlerinin hesaplanması gerekiyor. Bunun için PROPKA kullanacağız. Probka, pKa’ı ilgili amino asitin etrafındaki etkileşimlerine ve solvent erişebilir bir bölge olup olmama durmuna göre bize bir tahmin değer çıkarıyor. Önemli noktalardan biri her zaman Probka’dan elde ettiğimiz sonuca güvenmemeliyiz. Normalde pKa hesapları uzun ve zahmetlidir. Bu yüzde çıkan sonuçları kontrol etmeliyiz. Sonuca göre eğer elde edilen pKa değeri ortamın pH’sından düşük ise proton vermiş, eğer ortamın pH’sından -biz burada 7 olarak aldık- yüksek ise proton almış olarak düşünmeliyiz. Ayrıca elde ettiğimiz sonuçlarda çok olağan olmayan değerler elde edersek de bu amino asitlerin kontrollerinin yapılması gerek.

Probka’dan elde ettiğimiz sonuçlar aşağıda görülebilir. Burada pKmodel olarak yazan değerler, o amino asitin normal pH’da olan pKa değeridir. Ortadaki pKa ise bizim yapıdaki amino asitin pKa değeridir. Burada, GLU404’ün değeri normal değerinin yukarısında ve pH değerine yakın çıktığı için incelenmesinde yarar var. HIS’ler her zaman kontrol edilmesi gerekiyor. Çünkü histidinin protonasyonu normal pH’e çok yakın olduğu için protonasyonu çabuk değişim gösterebiliyor. Ayrıca bizim sistemde CYS440 ve CYS495 için elde edilen değerler ise normal pKa değerinden ciddi derecede farklı olduğundan incelenmesi gerek. Diğer değerler ise Probka’nın bir kaç birim hata yaptığını düşünsek bile çok bir değişiklik göstermeyeceğinden kabul edebiliriz.

SUMMARY OF THIS PREDICTION
     RESIDUE    pKa   pKmodel      RESIDUE    pKa   pKmodel 
   ASP 383 A    2.84      3.80   ASP 412 A    4.63      3.80
   ASP 422 A    4.77      3.80   ASP 434 A    4.56      3.80
   ASP 437 A    3.52      3.80   ASP 450 A    2.33      3.80
   ASP 458 A    3.78      3.80   ASP 459 A    1.14      3.80
   ASP 475 A    2.86      3.80   ASP 484 A    2.43      3.80
   ASP 488 A    3.43      3.80   ASP 510 A    2.96      3.80
   GLU 385 A    3.50      4.50   GLU 392 A    4.70      4.50
   GLU 393 A    4.86      4.50   GLU 404 A    6.38      4.50
   GLU 410 A    3.56      4.50   GLU 427 A    5.49      4.50
   GLU 456 A    4.99      4.50   GLU 468 A    3.44      4.50
   GLU 507 A    3.79      4.50   GLU 520 A    4.79      4.50
   C-  521 A    3.50      3.20   HIS 409 A    5.15      6.50
   HIS 413 A    6.64      6.50   HIS 457 A    6.16      6.50
   HIS 477 A    5.02      6.50   HIS 480 A    5.72      6.50
   CYS 440 A    4.13      9.00   CYS 495 A   15.62      9.00
   TYR 378 A   10.81     10.00   TYR 395 A   11.82     10.00
   TYR 405 A   10.14     10.00   TYR 411 A   10.33     10.00
   TYR 420 A   13.06     10.00   TYR 436 A   11.59     10.00
   TYR 494 A   11.71     10.00   TYR 514 A   11.53     10.00
   LYS 379 A   10.39     10.50   LYS 380 A   10.23     10.50
   LYS 387 A   10.70     10.50   LYS 416 A   10.51     10.50
   LYS 435 A    8.23     10.50   LYS 452 A   11.22     10.50
   LYS 489 A   10.69     10.50   LYS 502 A   10.64     10.50
   LYS 518 A   11.35     10.50   ARG 388 A   12.44     12.50
   ARG 447 A   13.07     12.50   ARG 465 A   12.62     12.50
   ARG 466 A   12.30     12.50   ARG 470 A   14.41     12.50
   ARG 472 A   12.33     12.50   ARG 487 A   12.36     12.50
   ARG 493 A   14.30     12.50   N+  378 A    7.55      8.00

Burada, GLU404 için bakacak inceleyecğiz. Eğer bir amino asit proteinin gömülü (hidrofobik) bir yerindeyse nötr olmayı isteyecektir. Ayrıca, elektrostatik etkileşimler, hidrofobik ortamda perdelenmez ya da çok az perdelenir, o yüzden yüklü olan amino asitler hidrofobik ortamda etrafındaki amino asitlerin pKa değerlerinde yakın olmasalar bile önemli bir değişime neden olur. Bu durum HIS amino asitlerinde daha çok dikkat edilmesi gerek bir durum. Burada bizim yapımızda GLU kısmen gömülü diyebileceğimiz bir bölgede olduğu için pKa’sında artışa neden olmuş olabilir. GLU’nun etrafındaki 4 Å mesafede olan amino asitlerle olan etkileşimleri incelememiz gerekiyor. Burada cevaplamamız gereken ilk soru, GLU’nun iyonize olmuş halini stabilize edebilecek amino asitler var mı ? Sonuç olarak, 3 tane hidrojen bağı yapabilecek durum söz konusu ve probkadan elde ettiğimiz sonucun makul olduğunu görüyoruz. Eğer proton alması gereken bir durum olduğunu düşünseydik ismini pdbde GLH olarak değiştirilmesi gerekecekti.

HIS için ise hepsinin kontrol edilmesi gerekiyor demiştik. Ama burada bir tanesini örnek olarak göstereceğiz. HIS için 4 farklı durum söz konusudur. İlki histidinin hem delta hem epsilon azotunda proton olmadığı hal -ki bu çok istisna bir durum olmadıkça olmuyor, o yüzden düşünülmesine gerek yok-, ikinci olarak deltada proton var epsilonda yok (ismini HID yapmalıyız), üçüncü olarak ikinci durumun tam tersi (ismini HIE yapmalıyız) ve son olarak ise ikisinde de proton var (ismini HIP yapmalıyız). HIS409 için baktığımızda, amino asitin bulunuduğu yerin kısmen su erişebileceği bir bölgede olduğunu görüyoruz. Ayrıca TYR411’in ana yapısındaki (backbone) azotu ile de bir hidrojen bağı yaptığı gözüküyor. Bir backbone azotta bir hidrojen olacağından HIS deltasında hidrojen olmamasını bekleriz. Bu yüzden epsilon azot üzerinde hidrojen var diyebiliriz ve ismini HIE olarak değiştiriyoruz. Diğer HIS’leri de bulunduğu lokasyonun solvent erişebilirliği ve etrafındaki etkileşimler açısından değerlendiriyoruz. Sonuç olarak, HIS413 için HID, HIS457 için HID ,HIS477 için HIP ve HIS480 için HIP olarak histidinleri tanımlamış olduk. Buradaki isim değiştirme işleminde önemli meselerden biri, eğer histidin HIS olarak bırakılırsa AMBER bunları otomatik olarak HIE olarak tanımlıyor. Bu yüzden istenmeyen bazı durumlar olabilir. Bu işlemleri yapmamızın en temel sebebi X-ray çalışmalarında hidrojenler görülmez, bu yüzden de bu atomların durumunun değerlendirilmesi gerekmektedir.

CYS440 ve CYS495 için bakacak olursak. X-ray de CYS495 için iki tane durum çözümlenmiş olarak duruyor. Bunlar, pdb içinde ACYS ve BCYS olarak tanımlanır. Bizim istediğimiz durum hangisi ise A ya da B den birinin olduğu tüm atomlar silinir ve geriye kalanların isimleri standart isimleriyle değiştirilir. Bizim durumumuzda BCYS disulfat bağ yapabilecek şekilde duruyorlar. Bu yüzden ACYS’e ait atomları sildik. BCYS isimini ise CYX olarak değiştirilmesi gerekiyor. Bundan dolayı CYS440 adını da CYX olarak değiştirilir. Eğer disulfat bağını istemeseydik BCYS’e ait atomlar silinir ve isimleri CYS olarak değiştirilirdi.

Bizim şuan incelediğimiz sistemde, pdbde yapılması gerekilen bir diğer değişiklik ise SER500 için yapılması gerek. Yukarıdaki CYS495’deki gibi burada da iki farklı durum için yapı çıkarılmış ve bunlardan birini tercih etmemiz gerek. Biz burada tamamen isteğe bağlı olarak ASER’i seçittik ve diğer atomları siliyoruz. ASER adını da SER olarak değiştiriyoruz.

  • Simülasyonda Kullanılacak Dosyaların Hazılanması

Bu aşamadan sonra ise hazırladığımız pdb dosyasını kullanarak topoloji ve koordinat dosyalarını oluşturacağız. Bu dosyaları minimizasyon ve simülasyon için kullanacağız. Bunun için AMBER’de bulunan “tleap” programını kullanacağız. Aşağıda topoloji ve koordinat dosyalarının oluşturulduğu kodlar yazılı.

[csaylan@local ]$ tleap
>source leaprc.protein.ff14SB
>source leaprc.water.tip3p
>x = loadpdb 1l1d_chainA.pdb
>solvateoct x TIP3PBOX 10
>charge x
>addions K+ 0
>bond x.440.SG x.495.SG
>saveamberparms x 1l1d_chainA.top 1l1d_chainA.incrd

Buradasource” ile başlayan komutlar ile, su ve protein için gereken parametreleri yüklüyoruz. Protein için günümüzde sıklıkla kullanılan ff14SB force-field’ını ve su için ise tip3p su tipinin parametrelerini ekledik. “loadpdbile pdb dosyamızı x adıyla tleap içinde tanıttık. “solvateoct” komutu ile trancated octahedron yapıda su ile dolu bir kutu oluşturduk. Bu kutunun boyutunu da proteinin yüzeyinden 10 Å mesafede olacak şekilde ayarladık. Kutunun nasıl alınması gerektiği çalışmadan çalışmaya önemli olabilir. Çünkü kutu içinde tamamen su ile kaplanacağı için sistemin toplam atom sayısı artacaktır. Toplam atom sayısına bağlı olarak da simülasyon için gereken zaman değişkenlik gösterecektir. Genelde küp şeklinde kutular alınır. Biz küpün kenerlarının kesilmiş olduğu yapı olan trancated octahedron kullandık, böylece bir miktar da olsa ihtiyaç olmayan suları silmiş olduk. Bu bizi simülasyondaki hesapsal iş yükünden bellirli bir oranda kurtaracaktır. Aynı zaman da ilerleyen aşamada anlatacağım periodik kutular arasında boşluk olamamasını da sağlamış olacağız. “charge” komutu bizim sistemimizin toplam yük miktarını veriyor. Bizim sistemimizin yükü -3. “addions” komutu ile net yükü sıfır yapmak için karşı iyon olarak K+ ekliyoruz. “bondkomutu ile de disulfat bağ yapacak CYS amino asitlerinin SG atomları arasında bağ olduğunu AMBER’e söylüyoruz. Son olarak ise bu yaptıklarımızı top ve incrd adında iki dosya olarak kaydediyoruz. Bu iki dosya minimizasyonda ve simülasyonda kullanılacak.

  • Minimizasyon

Bu aşamadan sonra minimizasyona geçiyoruz. Minimizasyon bir tür geometri optimizasyonudur. Başlangıç yapımızda olabilecek “steric clash” denilen atomların üst üste gelme durumundan kaynaklı , ve aynı zamanda atomlar arası bağların kısalığı ya da uzunluğundan kaynaklı enerjideki yüksek dalgalanmayı önlemek için sistemin enerjisini, üzerinde bulunduğu potensiyel enerji yüzeyindeki bir minimuma getirmek gerekiyor. Bu minimum bizim sistem geometrisinin en iyi olduğu bir yer olmasa da, simülasyonun başlaması için makul bir yer olacaktır. Eğer bu işlemi yapmazsak, enerjinin yüksekliğinden kaynaklı atomlar üzerindeki kuvvet ve -haliyle- hızların çok yüksek çıkmasına neden olacak. Bunun sonucunda da sistemimiz bir süre sonra dağılıp simülasyonun başarısız olmasına neden olur. AMBER için minimizasyonu yapmak için bir “.in” uzantılı bir dosya hazırlamamız gerekiyor. Aşağıda in dosyasının içeriği ve ayrıntıları yazıldı.

minimization
&cntrl
imin=1, ntmin=1, ncyc=250, ntb=1, cut=9,
drms=0.01, maxcyc=100000
&end

in” dosyamızın içinde ilk satır başlık satırıdır. Burayı kendimiz için not bıraktığımız bir alan olarak düşenebiliriz. Burada birden fazla satırdan oluşan bir yazı da yazabilirdik. “&cntrl den sonra AMBER’de ne yapılmasını istediğimizi yazmaya başlıyoruz. her bir kod arasında virgül olmak zorunda ve kodların sırası önemli değil. “imin=1” ile minimizasyon yapmak istediğimizi belirtiyoruz. “ntmin=1 ile de hangi minimizasyon algortihması kullanmak istediğimizi belirtiyoruz. Birden fazla minimizasyon algortihması var. Bunlar “non-derivative“, “first-derivative” ve “second-derivative” algoritmalar. “non-derivative” algoritmalar neredeyse hiç kullanılmaz, kullanılacaksa da elimizden hiçbir şey gelmiyor dediğimiz anlarda kullanılır, fakat kullanılması çok tavisye edilmez. Bu algoritmalara “simplex” örnek olarak verilebilir. “first-derivative” algoritmalar için “steepest descent” ve “conjuge gradient” örnek olarak verilebilir. “steepest descent” geometri minimumdan (aynı zamanda kuyunun dibi olarak da adlandırılır) uzakta ise bizi kuyunun dibine hızlıca yaklaştırır. Yalnız, hesaplama için kullandığı algoritmadan dolayı minimuma yaklaştıkça bulmakta zorlanır. “conjuge gradient” ise tam tersi kuynun dibinde uzak ise yaklaşmak uzun sürer ama minimuma yaklaşında minimumu bulmak kolaylaşır. Bu yüzden genelde önce bellirli bir adım kadar “steepest descent” yapılır ve sonra “conjuge gradient” algoritmasına geçiş yapılır. “ntmin=1″ komutu ile biz bunu AMBER’de tanımlamış oluyoruz. (Algoritmaların çalışmasını ve ayrıntılı bilgi için Andrew R Leach – Molecular modelling principles and applications (2001) kitabını inceleye bilirsiniz). “ncyc=250” kullanarak bizim kaç adım kadar “steepest descent” uygulayacağımızı söylüyoruz. Bu adımdan sonra “conjuge gradient” algortihmasına geçiş yapıyoruz.ntb=1” ise periodik kutu kullanacağız demek oluyor. Periodik kutu, sonsuz sayıda bizim proteininimizin bulunduğu kutunun replikasını yanyana üst üste getirilmesi ile oluşan yapıya deniyor. Bunun bize avantajı ise, sonsuz bir solvent ortamı yaratmamızı sağlıyor. Ama kullanılmayadabilinir, özellikle implict ve vakumda yapılan simülasyonlarda kullanılmaz. Aşağıdaki şekil periodik kutu işleyişi gösteriyor.
Elektrostaik etkileşimler “long range” denilen uzun mesafelerde bile etkisi görünen etkileşimlerdir. Bu etkileşimleri çok uzaklardaki atomlarda bile hesaplamak fazlasyıla performans gerektirecek bir iş olacağı için Particle Mesh Ewald yöntemini kullanacağız. Bu yöntem sadece periodik kutu var ise uygulanabilir. Bu yöntem ile atomların etrafına belirli bir yarı çapta küreler çizilir. Bu atomun üzerindeki elektrostatik etki bu küre içinde kalan atomlar ile normal olarak hesaplanır. Bu alan dışındakilerin etkisi ise yaklışık olarak eklenir. Bu yarı çap 8-10 Å arasında olması yeterlidir. Eğer periodik kutu kullanılmayacak ise elektrostatik etkileşimler için gereken yarı çap 30 Å’dan düşük olmaması gerekiyor. “cut = 9” komutumuz ile de 9 Å çapında bir küre kullanacağımızı belirtmiş oluyoruz. Aynı zamanda bu komutu kullanarak van der Waals etikleşimleri de bu küre içinde normal hesaplıyoruz ama küre dışını direk sıfır olarak hesaplamak istediğimizi belirtiyoruz.

Image pbc-seb

drms=0.01“; enerjinin minimum oladuğu nokta, potensiyel enerji yüzeyindeki bir kuyunun dibidir. Bu kuyunun dibinde enerjinin birinci türevi sıfır olması gerekiyor. Fakat bizim hesaplarımızda tam olarak sıfırı bulmak uzun zaman alabileceğinden belirli bir “convergence” dediğimiz yakınsama kriterine kullanmamız gerekiyor. Bu kriterin aşağısına geldiğimizde minimizasyonu duruduruyoruz. Bu yakınsama kriteri Root Mean Square Gradient (RMSG) değeridir ve bu değere bakarak minimizasyonun ne zaman bitmesini istediğimize karar veriyoruz. Ayrıntı için Andrew R Leach – Molecular modelling principles and applications (2001) kitabını inceleye bilirsiniz). Burada 0.01’lik bir yakınsama kriteri koyduk. “maxcyc=100000” sistemimiz oldu ki hatadan kaynaklı bir tekrara girdi o zaman maksimum adım değeri belirliyoruz ki sistemimiz bir yerde durabilsin, bu komutta da bunu belirttik. Yazacağımız tüm komutlar bitince de sonuna “&end” diyip sistemi minimizasyon için çalıştırmaya başlayabiliriz.

  • HPC iş gönderimi

Bu işlemler yüksek performas gerektirdiğinden ya özel hazırlamış iş istasyonlarında ya da bu işler için kullanılabilecek merkezlerdeki süper bilgisayarlarda iş gönderme usulüyle çalıştırılır. Bu merkezlerde genelde iş gönderimi Slurm İş Yükü Yöneticisi ile düzenlenir. Aşağıda minimizasyon için basit bir slurm iş gönderme betiği bulabilirsiniz. (örnek betik dosyaları için bknz. TRUBA kullanıcı el kitabı). Bu merkezlerde size tanımlı cpu time ve belli bir miktar dosya depolama alanı veriliyor. Bu alan ve zamandan harcayarak, işleri özelleşmiş kuyruklarda çalıştırıyorsunuz.

#!/bin/bash
#SBATCH -J 1l1d
#SBATCH -A csaylan              # account / proje adi
#SBATCH -n 20                   # cekirdek / islemci sayisi
#SBATCH -N 1                    # node sayisi
#SBATCH -p mid1 		# kuyruk

module load centos6.4/app/amber/14-openmpi-gcc
module load centos6.4/lib/openmpi/1.6.5-gcc

mpirun -np $SLURM_NPROCS $AMBERHOME/bin/pmemd.MPI -O  -i minimization.in  -c 1l1d_chainA.incrd -p 1l1d_chainA.top -o 1l1d_chainA.out -r 1l1d_chainA_min.rst
 
  • Simülasyon

Minimizasyon başarı ile bittikten sonra, simülasyon aşamasına geçebiliriz. Simülasyon için de mizimizasyon gibi bir in dosyası hazırlamamız gerekiyor. Aşağıda komutları detaylarıyla bahsettim.

simulation
&cntrl
imin = 0, cut = 9, ntb = 2, ntp = 1,
ntt = 3, gamma_ln = 5, tempi = 5, temp0 = 310,
dt = 0.002, ntc = 2, ntf = 2, nstlim = 2500000, 
ntwx = 2500, ntwe = 2500, ntpr = 100,
&end
&ewald
nfft1 = 90, nfft2 = 90, nfft3 = 90,
&end

imin = 0” komutu simülasyon yapacağımızı ifade ediyor. Burada biz NPT simülasyonu yapcağız. NPT simülasyonlarında, sistemdeki tanecik sayısının sabit ve sıcaklık ve basıncı dengelemek için sistemimize müdahale yaptığımız simülasyonlardır. NVE ve NVT gibi başka yöntemler de var. ntb = 2” komutu sabit basınçta simülasyonu yapmamızı ifade ediyor ve bu komut 2 yapıldığında her zaman ntp > 1 olacak bir komut eklenmesi gerekiyor. Ayrıca “ntb=2” minimizasyonda kullanılmaz çünkü minimizasyonda basınç tanımlı bir kavram değil. Bu komut ile basıncı ayarlamak için kullanacağımız “isotropic scaling” olarak bilinen algoritmayı kullanacağımızı ifade ediyoruz. Burada basınç hacim ile oynayarak sabitleniyor (diğer seçenekler için için bknz. AMBER Manual). “ntt = 3” komutu sıcaklığı ayarlamak için bir termostat kullandığımızın ifadesidir. 3 ile Langevin dynamics kullandığımızı gösteriyoruz. Langevin dynamics, sisteme sanal çarpmalar yaparak sıcaklığı arttırıyor.gamma_ln = 5” komutu ise bu sanal çarpmaların frekansını ifade ediyor. Bu değer 1/ps cinsindendir ve bu çarpmaları ne kadar sıklaştırırsak sistemin bozulmasına neden olacağından makul bir sıklık alınması önemlidir, bu yüzden 2-5 arası bir değer yeterlidir. Sistem büyüdükçe de bu değeri 2-3 civarında seçmek daha iyi olacaktır. tempi = 5, temp0 = 310” komutlarıyla sistemin sıcaklığının 5 K’den başlayıp 310 K’e ulaşmasını ve bu sıcaklıkta devam etmesini istediğimizi söylüyoruz. “dt = 0.002” ile time step dediğimiz adım aralığını belirliyoruz. Bu değer ps cinsindendir. Bu değer yüksek sıcaklıklarda bağlar arasındaki frekans artacağından düşürülmesi gerek. Çünkü bu zaman aralığı süresince hız sabit alınır ve uzun bir zaman aralığında sistemde bozulma meydana gelir. “ntc = 2” bu komutu ile SHAKE algoritmasını kullanmak istediğimizi söylüyoruz. SHAKE algoritması ile ağır atom hidrojen arasındaki “bond stretching” hareketi sabitlenir. Eğer SHAKE kullanılmayacaksa, zaman aralığı 0.001 alınması gerekiyor. “ntf = 2” komutu ile de sabitlediğimiz bu bağların enerji hesaplarının yapılamamsını istediğimizi söylüyoruz. Çünkü hiç değişmeyeceğinden sürekli hesap yapmak iş yükünü arttıracaktır. SHAKE algoritmasında ağır atom ağır atom arasındaki bağlar için de seçenekler var ama çok tavsiye edilmez. Çünkü sistemin konformasyonel değişimine zarar verir. Ayrıca SHAKE yapılabileneceği her durumda yapılmasında fayda vardır ve sıklıkla görebilirsiniz. Fakat minimizasyon sırasında SHAKE kullanmak doğru değildir. Bunun nedeni de biz hidrojenleri sonrasından eklediğimizden bundan kaynaklı hataları önlemek. nstlim = 2500000” bu komut sistemimiz kaç adım ilerlemesini istediğimizi bir diğer ifade ile simülasyon süremiz ne kadar olması gerek bunu söylüyoruz. Simülasyon süresi nstlim * dt şeklinde hesaplanır. Biz burada 5ns süreli bir simülasyon yapılmasını söyledik. Eğer simülasyonda çok uzun sürelere çıkacaksa bunu parçalar halinde yapılması hem sistemin karşılaşabileceği hatalardan kaynaklı veri kaybını önlemesini, hem de çok yüksek boyutta yer kaplayan bir dosyayı parçalara ayırarak taşımasını ve saklanabilirliğini arttırmayı sağlayacaktır. “ntwx = 2500, ntwe = 2500, ntpr = 100” bu komutlar ile belirli adımlarda sistemimizin koordinat ve sistem enerjisi gibi işe yarar bilgilerini yazılmasını söylüyoruz. ntwx koordinatlar için, ntwe enerji verileri için, ntpr daha anlaşılabilinir bir dil ile sistemin özetini içeren bir out dosyası çıkarması için kullanılır. Bu çıktılar sistem içi yanlışlıklarını anlayabilmemiz için önemlidir, bu nedenle özellikle ntpr için aldığımız aralığın daha az alınmasında fayda vardır. Burada çok sık yazım yapılırsa elimizde çok yüksek boyutlarda veri olabileceğinden seyrek aralıklarla ama Bu adım aralıkları arasındaki tüm veri kaybedilmiş olacak o yüzden de çok seyrek aralıklar seçilmemeli. Sonrasında da “&endkomutları bitiriyoruz. Ekstra komut için yeni bölüm tanımlamamız gerekiyor. Simülasyon in dosyamızda, PME için &ewald diyerek yeni bir bölüm açıyoruz. Burada belirttiğimiz komutlar “nfft1 = 90, nfft2 = 90, nfft3 = 90“. Bu komutları PME’de kullanılacak olan “charge grid”lerinin boyut büyüklüklerinin ifadesi için kullanıyoruz. Bu değerleri AMBER otomatik hesaplıyor. Bu değerleri minimizasyon çıktısında aratarak bulabilirsiniz. Daha detaylı bilgi için bknz. AMBER Manual. Bu değeri yüksek almak PME’nin doğruluğunu arttırırken, simülasyonun işlem yükünü arttırıcağından yavaşlatır. Tam tersinde ise simülasyon hızı artarken, PME’nin doğruluğu azalacaktır. Bundan sonra &end diyip bu bölümü kapatıyoruz. Sisteme restraint gibi ifadeler eklemek için de bu şekilde bölmeler açılıp gerekli olan komutları eklememiz gerekiyor.

Bu aşamadan sonra sistem, simülasyon yapılması için hazır durumda. Sistemi çalıştırmak için minimizasyonda yaptığımız gibi bir slurm betiği hazırlamak veya kendi iş istasyonumuzdan işi çalıştırabiliriz. Örnek olarak simülasyon betiği aşağıda bulabilirsiniz.

#!/bin/bash
#SBATCH -J 1l1d
#SBATCH -A csaylan              # account / proje adi
#SBATCH -n 20                   # cekirdek / islemci sayisi
#SBATCH -N 1                    # node sayisi
#SBATCH -p mid1 		# kuyruk

module load centos6.4/app/amber/14-openmpi-gcc
module load centos6.4/lib/openmpi/1.6.5-gcc

mpirun -np $SLURM_NPROCS $AMBERHOME/bin/pmemd.MPI -O  -i simulation.in  -c 1l1d_chainA_min.rst -p 1l1d_chainA.top -o 1l1d_chainA_1.out -r 1l1d_chainA_1.rst
 

Eğer sistemi gpu kullarak slurm üzerinden çalıştıracaksanız module load centos6.4/lib/cuda/5.5 gibi cuda için ilgili module yüklenmeli ve #SBATCH –gres=gpu:1 eklenerek sistemin kaç gpu kulanmasını istediğimizi belirtmeliyiz. Bunlara ek olarak pmemd.cuda komutu kullanılmalıdır.

Sistem çalışmasını bitirince de kordinat dosyalarını cpptraj gibi analiz yapabileceğiniz programlarla analizini yapabilirsiniz.

Referanslar

  1. Hollingsworth, S. A., & Dror, R. O. (2018). Molecular dynamics simulation for all. Neuron, 99(6), 1129-1143.
  2. Computational Biology: Structure and Organization of Biomolecules and Cells | Stanford Online. (2020). Alıntı tarihi 15 Temmuz 2020, http://web.stanford.edu/class/cs279/
  3. Leach, A. R., & Leach, A. R. (2001). Molecular modelling: principles and applications. Pearson education.

Metabolizmanın Matematiksel Modellenmesine Giriş

Aşağıdaki figürdeki gibi basit bir hücre düşünün: A metaboliti hücreye b1 hızında girebiliyor ve bu metabolit hücre içerisinde sırasıyla v1 ve v2 hızlarında B ve C metabolitlerine dönüşebiliyor. Aynı anda C metaboliti v3 hızında A’ya geri dönüşebiliyor. Tabii bütün bu dengeyi enzim kinetiklerini hesaba katmadan ve kütle dengesinin sağlandığını varsayarak kurmalıyız (bu cümle yazının devamında daha anlamlı hale gelecektir).

A picture containing clock

Description automatically generated

Yapacağımız diğer bir varsayım da hücrenin steady-state (kararlı durumda) olduğudur. Bu varsayımımız üzerine A metaboliti üzerinden geçen bütün reaksiyonları bilir hale geliyoruz ve A’nın üretildiği hızda tüketildiğini kabul ettiğimiz için aşağıdaki diferensiyel denklemi yazabiliyoruz:

Diğer bir deyişle, yukarıdaki denklemi yazarak hücre içerisinde A metabolitinin birikmeyeceğini kararlaştırmış olduk. Aynı denklemi B ve C metabolitleri için de yazarsak, 3 metabolit ve 7 reaksiyonlu bu diferensiyel denklemleri doğrusal denklem sistemi halinde ifade edebiliriz:

İfade ettiğimiz doğrusal denklem sistemini biraz daha açıklayalım: Oluşturduğumuz matrikste reaksiyonların stokiyometrik katsayılarını barındırıyoruz, bu matrikse “S matriksi” diyeceğiz. S matriksinin her bir sütunu tek bir reaksiyonu temsil ederken bu reaksiyona katılan metabolitler arasındaki bağlantılar hakkında bize bilgi verdiğini görebiliyoruz. Benzer şekilde, S matriksinin her bir satırı ise, bir metabolitin katıldığı tüm reaksiyonlar hakkında bilgi veriyor.  S matriksinin yanında gördüğümüz vektör ise bizim flux (akı) vektörümüz, metabolitlerin konsantrasyon değişikliklerini barındırıyor. Diğer bir deyişle, flux vektörü her metabolitin zamana bağlı akış hızını temsil ediyor.

Biyolojik ağlardaki reaksiyon sayısının büyüklüğünü düşündüğümüzde, bu sistemleri matematiksel olarak ifade ettiğimizde oluşacak S matriksinin boyutunun hayli büyük olacağını ve çoğunlukla 0 barındıracağını öngörebiliriz. Reaksiyon sayısının çok olması doğrusal denklem sistemini kararsız  (underdetermined) hale getirir ve bu sistemlerin tek bir çözümü yoktur.  

Modeli Kısıtlamak

Yukarıda bahsettiğimiz gibi, metabolik sistemlerin çözüm kümesi özgün değildir, yani S . v = 0 eşitliğini sağlayan birden fazla v vektörü bulunabilir. Biyolojik olarak daha anlamlı sonuçlar elde edebilmek için v vektörünü kısıtlandırılmış bir uzay içerisinden hesaplayabiliriz. Bu kısıtlamadan kastımız, biyolojik sistemlerin doğada uymak zorunda olduğu kuralların (kimyasal dengeler, termodinamik yasalar gibi) modelin çözüm kümesini daraltacak şekilde uygulanmasıdır.

Elle tutulur bir örnek vermek gerekirse, biyolojik sistmelerin fiziko-kimyasal özelliklerini düşündüğümüzde kütle ve yük dengesinin kurulması gerektiğini biliriz. Bu dengenin sağlanması için sisteme “zorunlu kısıtlama”lar getirmek kaçınılmaz olur. Örneğin bir reaksiyonun hangi yönde gerçekleştiği termodinamik yasalar ile belirlenmiştir. Bu reaksiyonlar matematiksel olarak sadece pozitif (vi ≥ 0, ileri yönde) ya da sadece negatif (vi 0, geri yönde) değerler alacak şekilde çözüm kümesini daraltabilir.

Başka bir kısıtlama örneği olarak deneylerin gerçekleştirildiği çevresel koşullar veya kültür medyasındaki değerlerin sisteme tanıtılması verilebilir. Hücre içerisine girebilecek besin miktarı (karbon, oksijen gibi) biliniyorsa, flux vektörü de o doğrultuda kısıtlandırılmalıdır.

Flux vektörünü kısıtlamak için pek çok yöntem kullanılabilir. Güncel çalışmalar protein miktarı, enzimatik aktivite, transkripsiyon miktarı gibi yeni nesil teknolojilerin sağladığı verileri de modelleri kısıtlamak için kullanmaktadır.

Flux Balance (Akı Denge) Analizi

Flux Balance Analizi (FBA), hücrelerin bir amaca doğru hayatlarını optimize ettiklerini öne sürer ve metabolik sistemleri bu doğrultuda çözmeye çalışır. Birden fazla sonuç içerisinden doğru flux vektörünü verebilmek için sisteme, genelde “büyüme reaksiyonu” olarak anılan, bir objektif fonksiyon dahil edilir. Bu büyüme reaksiyonu modellediğiniz hücreden hücreye farklılık gösterecektir. Genel hatlarıyla hücrenin biyokütle üretebilmesi ve üreyebilmesi için gerekli metabolitleri içeren son tüketim yeri olarak tanımlanır.

Matematiksel olarak anlatmak gerekirse, FBA aşağıdaki doğrusal problemi çözmeye çalışır:

A picture containing clock, meter

Description automatically generated

Bu denklemlerde c objektif fonksiyon vektörü, v flux vektörü ve S stokiyometrik matrikstir. Flux vektörünü sınırlayan vlb ve vub vektörleri, her bir fluxın alabileceği minimum (lower bound) ve maksimum (upper bound) değeri kısıtlayan vektörlerdir.

FBA, kısıtlandırılmış çözüm kümesi içerisinden objektif olarak tanıttığımız reaksiyonun maksimum değerini veren özgün vektörü bize sonuç olarak sunar. Bu sonucun biyolojik olarak anlamlılığı, objektif fonksiyon olarak ne tanımladığımıza bağlı olarak değişir.

Referanslar

  1. Pinzon, W., et al. “Mathematical Framework Behind the Reconstruction and Analysis of Genome Scale Metabolic Models.” Archives of Computational Methods in Engineering 26.5 (2019): 1593-1606.
  2. Orth, J. D., Thiele, I., & Palsson, B. Ø. (2010). What is flux balance analysis?. Nature biotechnology28(3), 245-248.

Bu yazıda metabolizmanın matematiksel modellenmesi üzerine kullandığım terimleri olabildiğince basitleştirmeye ve konu hakkında hiçbir bilgisi olmayan bir kişinin anlayabileceği bir şekilde açıklamaya çalıştım. Umarım başarılı olabilmişimdir. Konu hakkında Türkçe kaynak az olduğu için bu dilde yayınlamayı tercih ettim. İlgisini çekenlere referanslarda belirttiğim, okuması gerçekten kolay ve eğlenceli olan iki makaleyi kesinlikle okumalarını öneriyorum. Kendinize iyi bakın!

Plot plot veri görselleştirme: Volkan Plot

Renklerin İfade Etmek İstedikleri

Veri görselleştirme, verinin kendisi kadar önemli bir alan. Bilgiyi alıcıya aktaracak olan bu görseller. Kaldı ki bizler gibi büyük veri (big data & meta data) ve birçok disiplini bir araya toplayan disiplinlerarası (interdisciplinary) çağında yaşayan bilim insanları için, “araştırma hikayesini” anlatabilmenin en önemli yollarından biri de bu görsel sunum şölenleri olan veri görselleştirmeler.

Kişisel olarak da bilimin en renkli ve eğlenceli hallerinden biri olarak tanımlıyorum. Her gördüğüm yeni plot türünü deneme fırsatı yakalacağım o anı bekliyorum.

Öte yandan, o kadar çok plot türü var ki insan hangisini hangi veri için seçeceği konusunda zorlanıyor. Bu konuda grubumuzun aktif üyelerinden Melike Dönertaş’ın yapmış olduğu sunumu izlemenizi tavsiye ederim.


En bilinen RNA dizileme amacı olan diferansiyel gen ifadesi analizi ile başladığımızı düşünelim. RNA’yı izole ettik, sekansladık, sonra referans bir genomla eşleştirdik (mappingalignment), hangi genin ne kadar ifade edildiğine dair sayıları elde ettik (count) ve sonra farklılaşmış gen ifadesini (DEGs) analiz ettik (örneğin Deseq2 ya da egdeR kullanarak). Sonra da bunu görselleştirmek istedik.

Volkan (Yanardağ) Plot

Karşılaştırılacak iki durum olduğunu varsayalım (ilaç uygulanmış vs. kontrol). İlaç uygulandığında bazı genlerin ifadesi değişmiş-Differentially Expressed Genes, DEGs– (normalde fazla (upregulated) ya da az (downregulated) ifade olmuş olsun, bazıları da aynı kalmış, etkilenmemiş) olsun.

Artan/azalan gen ifadesi ve bunun p-değerlerini bir grafikte göstermek istediniz. Bazı genler yüksek/düşük ifade oluyor gibi gözükse de p-değeri yüksekse bu farkın bir önemi yok.

Soru: İstatistiksel olarak önemli kaç/hangi gen fark yarattı? Herhangi bir trend var mı?

Kendi tezimden bir volkano plot görseli, örnek olarak konulmuştur (Plotta ifade edilen verinin detayı için tezimi okumanızı öneririm). log2FC için sınır değeri 0.5849 seçilmişken, dikey nokta nokta çizgiye karşılık gelen değer; p değeri için sınır değeri 0.05 seçilmiştir, yatay eksendeki nokta nokta çizginin karşılık geldiği değer).

Genelde p değeri -log10 tabanında gösterilir (yani p<0.05 değeri 1 ile 2 arasında bir skalaya gelir-y ekseninde). P değeri 0.05’ten küçük olan her değer, y ekseninde daha büyük değere tekabül edecek.

Genelde DEG ifadesi de log2 tabanında gösterilir (yani mutlak log2FC, fold change (kat değişimi), değeri 0.5849 aslında 1.5 katı demek. Bu da birinde mesela 15 olan ifade, diğerinde 10 demek). Artan genler sağda, ifadesi azalanlar da solda kalıyor x ekseninde.


NS: Not significant (ne log2FC değeri sınırı aşabilmiş ne de p-değeri), abs: absolute (mutlak değer, artı eksisi olmadan) Griler, artıp azalma sınırının altında kalmış. Mavilerin değişimi önemli (p-değeri) ama değişim miktarı (log2FC) sınırın altında. Bunlar şu an ilgimizi çekmiyor.

Yeşillerin değişim miktarı (artış/azalış), sınır olan log2fc:0.5849’u aşmış ama p-değeri=>0.05 olduğu için sınıfta kalmışlar. Kırmızılar da hem değişim miktarı (ifadede artma azalma) büyük, sınırın üstünde, hem de karşılık gelen p-değeri rastgele olamayacak kadar önemli (0.05<). Kırmızılar, iki açıdan da (hem log2FC hem de pvalue) sınır değerini (treshold) geçen istatistiki olarak önemli değişime sahip azalan (x ekseninin solunda) ve artan (x ekseninin sağında) genleri ifade ediyor.

İlgili Kod

#İlgili kodun orjinali için şu siteye gidebilirsiniz: https://www.bioconductor.org/packages/release/bioc/vignettes/EnhancedVolcano/inst/doc/EnhancedVolcano.html

makeVolcanoPlot = function(df, mutant = 'AChE mutant', pCutoff = 0.05, FCcutoff =  0.5849) {
  
  EnhancedVolcano(df,
                  lab = row.names(df),
                  # eğer aradığınız bazı genleri nerde olduğunu görmek  istiyorsanız, dosyanızda hangi isimle eklediyseniz, ensembl id, gene name, vs. onları select lab ile seçerek grafikte yazılı olarak görmek mümkün.
                  #selectLab = c("arr3a","ache","fabp10a","pck1","rpe65a",
                  #              "mylz3","desma","rom1b","sagb","slc4a5"),
                  x = 'log2FoldChange',
                  y = 'pvalue',
                  # başlık eklemek isterseniz, title ı kullanabilirsiniz
                  title = paste(mutant, ' vs. Healthy'),
                  #subtitle ile ek alt başlık eklemek de mümkün
                  subtitle ="",
                  caption = paste0('Total = ', nrow(df), ' genes'),
                  captionLabSize = 10,
                  titleLabSize = 16,
                  subtitleLabSize = 1,
                  axisLabSize = 14,
                  transcriptPointSize = 1.0,
                  transcriptLabSize = 3.0,
                  # boxedlabels = TRUE,
                  pCutoff = pCutoff, #horizontal cut off line
                  FCcutoff = FCcutoff, #vertical cut off line
                  legend=c('NS',paste('abs(L2FC) > ', FCcutoff ),
                           paste('p-value < ', pCutoff),
                           paste('p-value<', pCutoff, '& abs(L2FC) > ', FCcutoff)),
                  legendPosition = 'top',
                  legendLabSize = 10,
                  legendIconSize = 3.0,
                  colAlpha = 1)
}

Peki ya daha fazlası mümkün mü?

Aslında bu grafik size, kırmızıları diğerlerinden ayırt etmekten biraz fazlasını sunuyor. Belki işte bu sebeple, veri görselleştirme ile yepyeni ufuklar kazanabilir, yepyeni sorular üretebilir ve yepyeni bir bakış açısı kazanabilirsiniz.

Bizim yukarıdaki grafik üzerinden anlatmak gerekirse,

  • artan ifadesi olan (x ekseni sağ taraf) gen sayısının azalış gösterenlere göre fazla olduğunu (x ekseni sol taraf)
  • artan ifadesi olan genlerin pek çoğunun önemli değişim değerine sahip olduğunu (x eksenindeki kırmızılar)
  • özellikle log2FC, kat değişimi, 0.5849 ile 2.5 arasında olan genlerin (x ekseninde sağa ve sola doğru nokta nokta dikey çizgiler ile 0 noktasında kalan alan), değişim miktarının verilen veri seti içinde uyumlu bir şekilde artış gösterdiği, rastgele olmadığını (önemli olarak kendini gösterdiğini)
  • log2FC değeri büyük değişim gösteren genlerin p değerinin de o derece düşük olduğunu (y ekseninde artan değer, aralıklı dağılmış kırmızı noktalar)
  • artış gösteren gen ifadesindeki değişimlerin azalış gösterenlere göre daha büyük olabileceğini (x ekseninin sağ tarafının sol tarafına göre daha uzun devam eden çizgide hala noktalara sahip olması) ve bunların önemli değişime sahip olması (kırmızı nokta olması) tek bir grafikten okuyabiliyoruz.

Bir arkadaşımın sorusu ile başlayan volkan plot grafik yorumlama serüvenimiz diğer plotlar ile devam edecek. Umarım sizler için de faydalı olmuştur. Böyle düşünüyorsanız, sizler de bu yazıyı paylaşarak, büyük paylaşımcı ailemize destek olabilirsiniz.

Sağlıcakla kalınız.

miRDeep2 – Ubuntu Bağlantısı Kullanarak miRNA Sekanslama Analizi

minik RNAlar (mikroRNAlar/miRNAs/microRNAs) gen kodlamayan küçük RNAlar grubunda bir aileye ait. 20-25 nükleotid uzunluğunda epey kısa diziler/sekanslar olsalar da vücuttaki pek çok sürecin yönetilmesinde, mRNA (mesajcı RNAlar/mRNAs) üzerinden söz sahibiler. RNA dizilemede (RNA sequencing) yeterli olan dizileme derinliği (sequencing depth)/ kapsamı (coverage), maalesef tek bazen farklı tek baz ile birbirinden ayrılan miRNAların farklılığının tespiti için yeterince hassas değil. Diziler çok kısa olduğu için, aynı tek nükleotid çeşitliliğinde (Single Nucleotide Polymorphism/SNPs) olduğu gibi, miRNAlar arasındaki farkı tespit etmek için derin dizileme teknikleri (deep sequencing) gerekiyor.

miRNAları araştırmak, yapılarını ortaya çıkarmak, ifade değerlerini karşılaştırmak için pek çok biyoenformatik araç mevcut. Ancak, RNA dizileme gibi kendisi dahi genç sayılacak bir alanda (Stark et al., 2019) , miRNA dizileme adeta henüz bebek adımlarını atıyor. Dolayısıyla miRNA dizilemeye yönelik biyoenformatik araçlar da bu tecrübesizlikten nasibini almış durumda. Varolan miRNA dizileme analizi araçları epey kısıtlı (Motameny et al., 2010; Kang and Friedlander, 2015; Chen et al., 2019). miRDeep2 (Mackowiak, S., 2011; Friedlander et al., 2012; Yang et al., 2011) ise en çok kullanılan, görece güncel olan araçlardan birisi. Kullanım amacı bilinen (known/canonical) ve bilinmeyen (unknown/non-canonical) miRNAları tespit etmek olan bu araç, ENCODE ( ENCODE Project Pipelines ) gibi proje iş akışları sunan çalışamlara karşı kolay kullanımlı bir alternatif olarak karşımıza çıkmakta.

mirDeep2, eski ve yeni (old, new) iki ayrı github sayfasında iki ayrı kod örneği (tutorial) verse de (old, new) eski olan sayfanın yanıltıcı olduğunu ve mutlaka yeni olan sayfadan (recent/newest github page) takip etmeniz gerektiğini hatırlatırım.

Her ne kadar bir örnek kod dizisi paylaşmış olsalar da bu aracı ilk kez indirip miRNA dizisi analizi yapacak arkadaşlarım için faydalı olacağını düşündüğüm bu yazıyı hazırlayarak dikkat edilmesi gereken bazı küçük noktaları sizinle de paylaşmak istedim.

1. Adım: Ubuntu Terminal indirmek

miRDeep2, pek çok biyoenformatik araç gibi Windows uyumlu değil ve linux ortamı gerektiriyor. Windows kullanıyorsanız öncelikle Microsoft Store/Mağaza’dan Ubuntu Terminal indirmenizi öneririm.

2. Adım: miRDeep2 indirmek için conda install kullanımı

Eğer miRDeep2’yu conda install kullnamadan indirmeyi deneyip indiremediyseniz endişelenmeyin, çünkü öyle inmeyebiliyor. Tasasız indirmeler için kesinlikle conda install öneririm. İndirdikten sonra inmiş mi diye test etmek için şu perl programcığını çalıştrmanızı öneririm: mapper.pl.

 dincaslan@D:~$ sudo apt-get update
 dincaslan@D:~$ sudo apt-get upgrade
 dincaslan@D:~$ cd /mnt/c/Users/USER/Downloads/

#Burada yeni bir Ubunut terminal açmanız gerekecektir. Şu linkteki bilgileri takip etmenizi öneririm: link. Dosyayı nereye indirmek istiyorsanız o yolu/lokasyonu berlirtmeniz lazım, ben Downloads'a indirmek istemiştim: "mnt/c/Users/...".

 dincaslan@D:~$ sha256sum  /mnt/c/Users/USER/Downloads/Anaconda3-2019.10-Linux-x86_64.sh 
 dincaslan@D:/mnt/c/Users/USER/Downloads$ bash /mnt/c/Users/USER/Downloads/Anaconda3-2019.10-Linux-x86_64.sh
 dincaslan@D:/mnt/c/Users/USER/Downloads$ source ~/.bashrc
 (base) dincaslan@D:/mnt/c/Users/USER/Downloads$ conda config --set auto_activate_base
 (base) dincaslan@D:/mnt/c/Users/USER/Downloads$ conda config --set auto_activate_base True
 (base) dincaslan@D:/mnt/c/Users/USER/Downloads$ conda list
 (base) dincaslan@D:/mnt/c/Users/USER/Downloads$ conda install -c bioconda mirdeep2
 (base) dincaslan@D:/mnt/c/Users/USER/Downloads$ mapper.pl 

3. Adım: mirDeep2 Örnek Tutorial Kodunu Çalıştırmak

Tabi bu toplu kodu çalıştırmadan önce, gereken tüm dosyalar hazır mı emin olmak lazım. Mature ve hairpin fasta dosylarını şuradan indirebilirisiniz: miRBase.

#Tutorial dosyasını indirmek istediğiniz dizini seçmeniz gerekiyor.
#cd ilgili dosya/yolu açmak için kullanıyoruz. 
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ cd drmirdeep.github.io-master/

#ls komutunu da ilgili yerdeki dosyaları görüntülemek için kullanıyoruz.

(base) dincaslan@D:/mnt/c/Users/USER/Downloads/drmirdeep.github.io-master$ ls
(base) dincaslan@D:/mnt/c/Users/USER/Downloads/drmirdeep.github.io-master$ cd drmirdeep.github.io-master/
(base) dincaslan@D:/mnt/c/Users/USER/Downloads/drmirdeep.github.io-master/drmirdeep.github.io-master$ ls

#Dyelim ki TGGAATTC sizin adaptör sekans olsun. grep ile örneğinizde ne kadar okuma buna sahip analayabilirsiniz.
(base) dincaslan@D:/mnt/c/Users/USER/Downloads/drmirdeep.github.io-master/drmirdeep.github.io-master$ grep -c TGGAATTC example_small_rna_file.fastq
2001

#mirbase sitesinden ilgili dosyaları indirip gerekli bilgileri, programın anlayacağı biçimde çıkarmayı unutmayın

(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ extract_miRNAs.pl /mnt/c/Users/USER/Downloads/mature.fa hsa > /mnt/c/Users/USER/Downloads/mature_hsa.fa  
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ extract_miRNAs.pl /mnt/c/Users/USER/Downloads/hairpin.fa hsa > /mnt/c/Users/USER/Downloads/hairpin_hsa.fa  
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ extract_miRNAs.pl /mnt/c/Users/USER/Downloads/mature.fa mmu,chi > /mnt/c/Users/USER/Downloads/mature_other_hsa.fa 

#bowtie1 ile ilgili referans genom dosyası üzerinden index dosyası hazırlıyoruz, eşleştirme adımı için
(base) dincaslan@D:/mnt/c/Users/USER/Downloads/drmirdeep.github.io-master/drmirdeep.github.io-master$ bowtie-build refdb.fa refdb.fa

#burada çok önemli bir nokta var.
#map edebilmek için referans dosyanız, indexed dosya olmalı.
(base) dincaslan@D:/mnt/c/Users/USER/Downloads/drmirdeep.github.io-master/drmirdeep.github.io-master$ mapper.pl example_small_rna_file.fastq -e -h -i -j -k TGGAATTC -l 18 -m -p refdb.fa -s reads_collapsed.fa -t reads_vs_refdb.arf -v -o 4

#to run the mirdeep2 analysis. You can find the detailed information regarding the parameters in the paper and the tutorial page.
#buradaki referans dosyası index olmayan, düz fasta dosyası, en başta elinizde olan.
(base) dincaslan@D:/mnt/c/Users/USER/Downloads/drmirdeep.github.io-master/drmirdeep.github.io-master$ miRDeep2.pl reads_collapsed.fa refdb.fa reads_vs_refdb.arf mature_ref.fa mature_other.fa hairpin_ref.fa -t hsa 2>report.log

4. Adım: miRDeep2’yu kendi örneğiniz üzerinden çalıştırmak

MiRDeep2’yu çalıştırmadan önce, fastq, dizileme dosyanızın, kalitesini kontrol etmek isteyebilirsiniz. Bunun için fastqc aracının indirmeniz gerekiyor. Daha sonra da gerekecek adaptör dizisi ya da çoklu A (poly-A) zincirinin kesilmesi için cutadapt kullanmanız gerekebilir. miRDeep2’nun da adaptör kesme fonksiyonu olsa da verinizim ihtiyacına binaen cutadapt gibi araçlar daha çok işinizi görebilir.

#for fastqc
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ sudo apt-get update
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ sudo apt-get install fastqc
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ fastqc --extract /mnt/c/Users/USER/Downloads/S26.fastq.gz -o /mnt/c/Users/USER/Downloads/fastqc_results

#for cutadapt and fastqc after
#Lets say your adapter sequence is this: TAGCTGATCGATCTGAAACT
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ conda install -c bioconda cutadapt
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ cutadapt -a TAGCTGATCGATCTGAAACT /mnt/c/Users/USER/Downloads/S26.fastq > /mnt/c/Users/USER/Downloads/outputS26.fastq
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ fastqc --extract /mnt/c/Users/USER/Downloads/outputS26.fastq -o /mnt/c/Users/USER/Downloads 

#before this step, you need to download a reference file in fasta/fa format.
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ bowtie-build ucsc_hg19.fasta ucschg19

#You do not need to add .fa extension to file that you index
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ mapper.pl S26.fastq -e -h -i -j -k TAGCTGATCGATCTGAAACT-l 18 -m -p ucschg19 -s R___collapsed.fa -t R___refdb.arf -v -o 4

#You need to use index file as a reference here
(base) dincaslan@D:/mnt/c/Users/USER/Downloads$ miRDeep2.pl R___collapsed.fa ucsc_hg19.fasta R___refdb.arf mature_hsa.fa mature_other_hsa.fa hairpin_hsa.fa -t hsa 2> report.log

Umarım bu yazıyı faydalı buldunuz. Aralarda verilen websitelerin ek olarak, her hangi bir sorunuz olmanız durumunda şu siteden istifade etmenizi şiddetle öneririm: biostar.

Conda install’ı akıl etmeden önce eski örnek kod üzerinden indirmeye çalışırken can çekişirken 😛 bana çok yardımı dokunan kıymeli labdaşım (lab arkadaşım) Daniel’e ve AkademikTwitter’ın Biyoenformatik alanında bilinen simalarından Dr. Ming Tang’in beni kaale alıp özellikle bir noktayı aydınlatmasından ötürü çok teşekkür ederim.

Referaslar:

Stark, R., Grzelak, M. & Hadfield, J. RNA sequencing: the teenage years. Nat Rev Genet20, 631–656 (2019). https://doi-org.libproxy1.nus.edu.sg/10.1038/s41576-019-0150-2

Motameny, S.; Wolters, S.; Nürnberg, P.; Schumacher, B. Next Generation Sequencing of miRNAs – Strategies, Resources and Methods. Genes 2010, 1, 70-84. https://doi.org/10.3390/genes1010070

Kang W, Friedländer MR. (2015) Computational prediction of miRNA genes from small RNA sequencing data. Front Bioeng Biotechnol 3: 7 10.3389/fbioe.2015.00007

Liang Chen, Liisa Heikkinen, Changliang Wang, Yang Yang, Huiyan Sun, Garry Wong, Trends in the development of miRNA bioinformatics tools, Briefings in Bioinformatics, Volume 20, Issue 5, September 2019, Pages 1836–1852, https://doi-org.libproxy1.nus.edu.sg/10.1093/bib/bby054

Mackowiak, S. D. Identification of novel and known miRNAs in deep-sequencing data with miRDeep2. Curr Protoc BioinformaticsChapter 12, Unit 12 10, 10.1002/0471250953.bi1210s36 (2011).

Xiaozeng Yang, Lei Li, miRDeep-P: a computational tool for analyzing the microRNA transcriptome in plants, Bioinformatics, Volume 27, Issue 18, 15 September 2011, Pages 2614–2615, https://doi-org.libproxy1.nus.edu.sg/10.1093/bioinformatics/btr430

Marc R. Friedländer, Sebastian D. Mackowiak, Na Li, Wei Chen, Nikolaus Rajewsky, miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades, Nucleic Acids Research, Volume 40, Issue 1, 1 January 2012, Pages 37–52, https://doi-org.libproxy1.nus.edu.sg/10.1093/nar/gkr688

https://www.encodeproject.org/microrna/microrna-seq/



Life Science Zurich Graduate School

Herkese merhabalar!

Merak edenler için Life Science Zurich Graduate School‘a başvuru ve mülakat sürecini anlatacağım. Öncelikle, lütfen yazdıklarımı genel geçer kurallar olarak değil, sadece kişisel deneyim olarak görünüz ve programın websitesini inceleyerek en doğru ve güncel bilgilere ulaşınız 🙂 Program ile alakalı tüm bilgilere şuradan ulaşabilirsiniz: https://www.lifescience-graduateschool.uzh.ch/en.html. Burada bahsedeceğim bilgilerin birçoğuna ve belki daha fazlasına linkin altında bulunan sıkça sorulan sorular bölümünden de ulaşabilirsiniz!

Bu program University of Zurich ve ETH’nin ortak olarak yürüttüğü ve içerisinde toplamda 17 farklı doktora programı barındıran bir proje. Bu programlardan bazıları: Evrimsel Biyoloji, Sinirbilim, Bitki Bilimi, RNA Biyolojisi, Sistem Biyolojisi, Kanser Biyolojisi vb. diyerek liste uzayıp gidiyor (https://www.lifescience-graduateschool.uzh.ch/en/about-LSZGS/phd-programs.html). Bu okula başvurmanın iki yolu var. Birincisi “Track 1”, ikincisi ise “Track 2”. Burada benim deneyimim olan Track 1’den bahsedeceğim. Okula başvurular iki dönem açılıyor. Bunlardan bir tanesinin son başvuru tarihi 1 Temmuz, diğerinin son başvuru tarihi ise 1 Aralık. Tabii, mutlaka değişiklik olup olmadığına bakmanızı tavsiye ederim. Genel olarak değinmek gerekirse, açılacak pozisyonları maalesef önceden göremiyoruz ve sadece online başvuru sürecini (preselection) geçtiyseniz, açık pozisyonları görebiliyorsunuz. Ancak, bazı hocalar açık pozisyonlarını sosyal medya vb. mecralarda duyurdukları gibi, bizzat hoca ile iletişime geçip pozisyonu olup olmadığını sormak da bir seçenek olabilir (mesela bunu yapmak programın websitesinde önerilmeyen bir durum). 

Online başvuru sırasında size sorulan sorular ve istenen belgeler şu şekilde: 

  1. Diplomalarınız, 
  2. Şimdiye kadar hangi projelerde yer aldığınız: yaklaşık kaç ay yer aldığınız, ve özellikle projelere sizin nasıl katkı sağladığınız, 
  3. Eğer makaleleriniz varsa bunların listesi, 
  4. Hangi araştırma alanlarını daha ilgi çekici bulduğunuz ve bunun nedenleri (en önemli sorulardan bir tanesinin bu olduğunu düşünüyorum), 
  5. Bildiğiniz diller ve hobileriniz, 
  6. Transkriptleriniz, 
  7. En fazla üç referans (ben iki referans girmiştim) 
  8. Hangi doktora programını tercih etmek istediğiniz (iki seçim yapabiliyorsunuz). 

Bu noktada en çok sorulan sorulardan bir tanesi dil puanı istenip istenmediği. En azından kanser biyolojisi PhD programında herhangi bir dil puanı ne bu aşamada ne de kayıt aşamasında isteniyor. Bildiğim kadarıyla bu şart bölümden bölüme ya da UZH/ ETH olmasına göre değişebilir. İlgilendiğiniz bölüm ile iletişime geçip bunu sorabilirsiniz.

Eğer bu aşamayı (preselection) geçerseniz, Zürih’e mülakata davet ediliyorsunuz. Gidiş-geliş uçak masrafları, vize masraflarınız, konaklama masrafları, şehir içi ulaşım masraflarının hepsi program tarafından karşılanıyor (siz mülakattan döndükten sonra karşılanıyor). Uçak biletinizi ne zaman/hangi tarihler arasında alacağınız, program tarafından sizinle iletişime geçilerek söyleniyor. Burada önemli olabilecek başka bir konu ise, vizeye benim bildiğim bir tek Ankara ve İstanbul’da bulunan TLSContact firması aracılığı ile başvurabiliyorsunuz. İlk geldiğiniz gün havaalanından alacağınız bilet ile otele ulaşım sağlayabiliyorsunuz. Bu bileti saklarsanız, onun ücretini de size geri veriyorlarmış. Onun dışındaki ulaşımlarınızı, size otele ulaştığınızda verilen dosyanın içerisinde bulunan ulaşım kartı ile sağlayabilirsiniz.

Başvuru sırasında seçilenden başka bir doktora programına kaydolunabilir mi?

Bu konuya ayrıca değinmek istedim. Doktora programı seçerken dikkat etmeniz gereken en önemli şeylerden bir tanesi bence bu. Çünkü ilk aşamayı geçtikten sonra, bütün açık pozisyonları görebileceksiniz ve bu pozisyonlardan toplamda 8 tane proje/lab seçme hakkınız olacak. Seçim yaparken, bu 8 projenin ilk 3 tanesi sizin seçtiğiniz (mülakata çağıran) programdan olmak zorunda. Geri kalan 5 tanesi ise başka programlardan olabilir. Daha sonra lab yürütücüleri de sizin başvurunuzu inceleyip, eğer sizinle görüşmek isterlerse o zaman birebir mülakatlar ayarlanıyor. Hangi laboratuvarlarla hangi gün görüşeceğiniz bilgisi, siz Zürih’e varmadan belirleniyor. Yani başka bir programdan bir lab ile anlaşmak da mümkün. Proje/lab seçerken sıralama kısmı önemli, bazı laboratuvarlar için onları hangi sıraya koyduğunuz önemli olabilir, o yüzden istediğiniz bir laboratuvarı yanlışlıkla kaçırmayın. Şunu da ayrıca eklemem gerekir ki, eğer görüşmek istediğiniz ancak açık pozisyonu olmayan bir lab olursa da program bu konuda fazlasıyla destekleyici. Siz görüşme ayarlayabilirseniz sizin mülakat listenize o laboratuvarı da ekliyorlar.

Mülakat Süreci Nasıl Oluyor?

Şimdi Zürih’e geldiniz, hangi laboratuvarlarla görüşeceğiniz de belli. Ama her şeyden önce programın yaptığı mülakatı geçmek gerekiyor. Bu mülakat ilk gün oluyor ancak, eğer 8-10 tane lab ile görüşecekseniz program mülakatınızdan önce birebir görüşmeniz de olabilir. Kesin bir sırası yok. Ben toplamda üç lab ile görüştüğüm için, ilk gün lab görüşmem yoktu. Programın yaptığı mülakatta sizden en fazla 15 dakika boyunca tezinizi veya yaptığınız başka bir çalışmayı sunmanızı bekliyorlar. Sunum sonunda ise genellikle sunduğunuz proje ile alakalı sorular soruluyor (en azından benim mülakatım öyleydi). Sonuçlar ise akşam düzenlenen bir etkinlikte elinize mektup ile ulaşıyor 🙂 Bu programın belki de en güzel yanlarından birisi, eğer bu mülakatı geçtiyseniz, bir laboratuvar ile bu süreçte anlaşamasanız bile size 6 aylık bir zaman vermeleri. Bu sürede başka bir lab bulursanız yine kayıt yaptırabiliyorsunuz. 

Birebir mülakatlar için çoğu lab yürütücüsü sizi laboratuvardaki diğer PhD/Postdoc’lar ile tanıştırıyor ve çoğu onların fikrine de oldukça önem veriyor. Ancak, her laboratuvatın hem sizde merak ettikleri şeyler farklı olduğundan, hem de önem verdikleri değerler farklı olduğundan burada maalesef birebir görüşmelerin nasıl olacağına dair bir yorumda bulunamıyorum. Sizin bu görüşmeler sırasında diğer doktora öğrencilerine ve PI’a neler sorabileceğiniz ile ilgili bir sayfa soru, hali hazırda program tarafından size veriliyor zaten ve oldukça yardımcı oluyor bu sorular.

Hangi Okula Kayıt Yaptırılıyor?

Mülakatı geçtiniz, istediğiniz laboratuvar ile anlaştınız, peki hangi okula kayıt yaptıracaksınız? Lab yürütücünüzün ilişik olduğu okul hangisi ise ona kayıt yaptırıyorsunuz. Eğer sizin için ETH veya UZH olması önemli ise, en baştan lab seçim kriterlerinize bunu ekleyebilirsiniz. Bildiğim kadarıyla okullara kayıt koşulları da hem okulun kendi içerisinde, hem program bazlı değişebilmekte.

Değinmek istediğim son konu ise program maaş sağlıyor mu? Evet, doktora süreciniz boyunca maaş alıyorsunuz. Son olarak dediğim gibi, bu bilgiler her sene değişebilir/güncellenebilir o yüzden lütfen kontrol ediniz. Yazıyı mülakat sürecinde çektiğim bir fotoğraf ile kapatmak istiyorum 🙂 Eğer başvurmayı düşünürseniz, şimdiden bol şanslar!

Molecular Simulations as an in silico Experiment – Seyit Kale

Sunan Kişi

This image has an empty alt attribute; its file name is seyit.kale.500px.JPG

Seyit Kale

Seyit Kale received his Bachelor of Science in Physics from İhsan Doğramacı Bilkent University in 2006, and his Ph.D. in Biophysics and Structural Biology from Brandeis University in 2012. He continued his postdoctoral studies at the University of Chicago, developing methods for computational chemistry. Later in 2015, he became a visiting fellow at the National Institutes of Health in Bethesda, Maryland, where he developed and pursued an interest in the physics of chromatin and epigenetics. He joined Izmir Biomedicine and Genome Center in late 2019 as a research group leader where he is currently running a lab in computational biophysics.

Özet

Structural studies in biology provide invaluable insights into how molecular machines inside our cells look like, yet the stories are often far from over. The set of atomic coordinates of a macromolecule is like a picture: it’s worth a thousand words. Then again, a picture lacks the temporal information which underlies the dynamic personalities of the molecule. Over the last several decades, exponential growth in computing power drew increasingly more physical scientists toward questions of life sciences. Faster algorithms and more accurate interaction potentials have been developed to propagate the Newtonian equations of motion in length- and timescales relatable to biological phenomena. In this lecture, I will discuss an often frowned upon analogy, i.e., how a molecular simulation can be thought of as an in silico experiment, by providing a historical and physical perspective.

Tarih: 5 Mart 2020 – 17:00 (TSİ)

Dil: İngilizce

Aşağıdaki linkten webinara kayıt olabilirsiniz:
https://www.bigmarker.com/bioinfonet/Molecular-Simulations-as-an-in-silico-Experiment

RSG-Turkey is a member of The International Society for Computational Biology (ISCB) Student Council (SC) Regional Student Groups (RSG). We are a non-profit community composed of early career researchers interested in computational biology and bioinformatics.

Contact: turkey.rsg@gmail.com

Sosyal medyada bizi takip edin!